spacer

MicroRNA Listing for Homo sapiens


851 microRNAs (711 native)


Page 1 of 9
1 2 3 4 5 6 7 8 9 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
1012 picture button
hsa-let-7e* let-7* Homo sapiens
CUAUACGGCCUCCUAGCUUUCC
1097 picture button
hsa-let-7b* let-7* Homo sapiens
CUAUACAACCUACUGCCUUCCC
1090 picture button
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
1010 picture button
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
1032 picture button
hsa-let-7f-2* let-7* Homo sapiens
CUAUACAGUCUACUGUCUUUCC
1132 picture button
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
1034 picture button
hsa-let-7d* let-7* Homo sapiens
CUAUACGACCUGCUGCCUUUCU
1137 picture button
hsa-let-7a* let-7* Homo sapiens
CUAUACAAUCUACUGUCUUUC
1066 picture button
hsa-let-7i* let-7* Homo sapiens
CUGCGCAAGCUACUGCCUUGCU
1092 picture button
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
1046 picture button
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
974 picture button
hsa-let-7f-1* let-7* Homo sapiens
CUAUACAAUCUAUUGCCUUCCC
1055 picture button
hsa-let-7c* let-7* Homo sapiens
UAGAGUUACACCCUGGGAGUUA
1010 picture button
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
985 picture button
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
1039 picture button
hsa-let-7g* let-7* Homo sapiens
CUGUACAGGCCACUGCCUUGC
1176 picture button
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
901 picture button
hsa-miR-7 miR-7 Homo sapiens
UGGAAGACUAGUGAUUUUGUUGU
1070 picture button
hsa-miR-7-2* miR-7* Homo sapiens
CAACAAAUCCCAGUCUACCUAA
733 picture button
hsa-miR-7-1* miR-7* Homo sapiens
CAACAAAUCACAGUCUGCCAUA
739 picture button
hsa-miR-9* miR-9* Homo sapiens
AUAAAGCUAGAUAACCGAAAGU
774 picture button
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
1028 picture button
hsa-miR-10a* miR-10* Homo sapiens
CAAAUUCGUAUCUAGGGGAAUA
793 picture button
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
961 picture button
hsa-miR-10b* miR-10* Homo sapiens
ACAGAUUCGAUUCUAGGGGAAU
905 picture button
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
988 picture button
hsa-miR-15b miR-15 Homo sapiens
UAGCAGCACAUCAUGGUUUACA
1071 picture button
hsa-miR-15b* miR-15* Homo sapiens
CGAAUCAUUAUUUGCUGCUCUA
819 picture button
hsa-miR-15a miR-15 Homo sapiens
UAGCAGCACAUAAUGGUUUGUG
1112 picture button
hsa-miR-15a* miR-15* Homo sapiens
CAGGCCAUAUUGUGCUGCCUCA
793 picture button
hsa-miR-16 miR-16 Homo sapiens
UAGCAGCACGUAAAUAUUGGCG
1035 picture button
hsa-miR-16-2* miR-16* Homo sapiens
CCAAUAUUACUGUGCUGCUUUA
718 picture button
hsa-miR-16-1* miR-16* Homo sapiens
CCAGUAUUAACUGUGCUGCUGA
772 picture button
hsa-miR-17 miR-17 Homo sapiens
CAAAGUGCUUACAGUGCAGGUAG
1416 picture button
hsa-miR-17* miR-17* Homo sapiens
ACUGCAGUGAAGGCACUUGUAG
797 picture button
hsa-miR-18b miR-18 Homo sapiens
UAAGGUGCAUCUAGUGCAGUUAG
932 picture button
hsa-miR-18b* miR-18* Homo sapiens
UGCCCUAAAUGCCCCUUCUGGC
814 picture button
hsa-miR-18a miR-18 Homo sapiens
UAAGGUGCAUCUAGUGCAGAUAG
961 picture button
hsa-miR-18a* miR-18* Homo sapiens
ACUGCCCUAAGUGCUCCUUCUGG
687 picture button
hsa-miR-19a miR-19 Homo sapiens
UGUGCAAAUCUAUGCAAAACUGA
1044 picture button
hsa-miR-19a* miR-19* Homo sapiens
AGUUUUGCAUAGUUGCACUACA
722 picture button
hsa-miR-19b-2* miR-19* Homo sapiens
AGUUUUGCAGGUUUGCAUUUCA
813 picture button
hsa-miR-19b miR-19 Homo sapiens
UGUGCAAAUCCAUGCAAAACUGA
1046 picture button
hsa-miR-19b-1* miR-19* Homo sapiens
AGUUUUGCAGGUUUGCAUCCAGC
800 picture button
hsa-miR-20a* miR-20* Homo sapiens
ACUGCAUUAUGAGCACUUAAAG
869 picture button
hsa-miR-20b miR-20 Homo sapiens
CAAAGUGCUCAUAGUGCAGGUAG
1374 picture button
hsa-miR-20b* miR-20* Homo sapiens
ACUGUAGUAUGGGCACUUCCAG
747 picture button
hsa-miR-20a miR-20 Homo sapiens
UAAAGUGCUUAUAGUGCAGGUAG
1200 picture button
hsa-miR-21* miR-21* Homo sapiens
CAACACCAGUCGAUGGGCUGU
883 picture button
hsa-miR-21 miR-21 Homo sapiens
UAGCUUAUCAGACUGAUGUUGA
1000 picture button
hsa-miR-22 miR-22 Homo sapiens
AAGCUGCCAGUUGAAGAACUGU
1044 picture button
hsa-miR-22* miR-22* Homo sapiens
AGUUCUUCAGUGGCAAGCUUUA
854 picture button
hsa-miR-23b miR-23 Homo sapiens
AUCACAUUGCCAGGGAUUACC
1049 picture button
hsa-miR-23b* miR-23* Homo sapiens
UGGGUUCCUGGCAUGCUGAUUU
741 picture button
hsa-miR-23a miR-23 Homo sapiens
AUCACAUUGCCAGGGAUUUCC
1078 picture button
hsa-miR-23a* miR-23* Homo sapiens
GGGGUUCCUGGGGAUGGGAUUU
820 picture button
hsa-miR-24 miR-24 Homo sapiens
UGGCUCAGUUCAGCAGGAACAG
980 picture button
hsa-miR-24-2* miR-24* Homo sapiens
UGCCUACUGAGCUGAAACACAG
810 picture button
hsa-miR-24-1* miR-24* Homo sapiens
UGCCUACUGAGCUGAUAUCAGU
834 picture button
hsa-miR-25 miR-25 Homo sapiens
CAUUGCACUUGUCUCGGUCUGA
983 picture button
hsa-miR-25* miR-25* Homo sapiens
AGGCGGAGACUUGGGCAAUUG
595 picture button
hsa-miR-26a-2* miR-26* Homo sapiens
CCUAUUCUUGAUUACUUGUUUC
767 picture button
hsa-miR-26a miR-26 Homo sapiens
UUCAAGUAAUCCAGGAUAGGCU
950 picture button
hsa-miR-26a-1* miR-26* Homo sapiens
CCUAUUCUUGGUUACUUGCACG
839 picture button
hsa-miR-26b* miR-26* Homo sapiens
CCUGUUCUCCAUUACUUGGCUC
796 picture button
hsa-miR-26b miR-26 Homo sapiens
UUCAAGUAAUUCAGGAUAGGU
908 picture button
hsa-miR-27b miR-27 Homo sapiens
UUCACAGUGGCUAAGUUCUGC
1074 picture button
hsa-miR-27b* miR-27* Homo sapiens
AGAGCUUAGCUGAUUGGUGAAC
851 picture button
hsa-miR-27a miR-27 Homo sapiens
UUCACAGUGGCUAAGUUCCGC
1081 picture button
hsa-miR-27a* miR-27* Homo sapiens
AGGGCUUAGCUGCUUGUGAGCA
878 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
1093 picture button
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
987 picture button
hsa-miR-29a* miR-29* Homo sapiens
ACUGAUUUCUUUUGGUGUUCAG
1013 picture button
hsa-miR-29a miR-29 Homo sapiens
UAGCACCAUCUGAAAUCGGUUA
1117 picture button
hsa-miR-29b-2* miR-29* Homo sapiens
CUGGUUUCACAUGGUGGCUUAG
895 picture button
hsa-miR-29c miR-29 Homo sapiens
UAGCACCAUUUGAAAUCGGUUA
1156 picture button
hsa-miR-29b-1* miR-29* Homo sapiens
GCUGGUUUCAUAUGGUGGUUUAGA
961 picture button
hsa-miR-29b miR-29 Homo sapiens
UAGCACCAUUUGAAAUCAGUGUU
1152 picture button
hsa-miR-29c* miR-29* Homo sapiens
UGACCGAUUUCUCCUGGUGUUC
1011 picture button
hsa-miR-30d miR-30 Homo sapiens
UGUAAACAUCCCCGACUGGAAG
995 picture button
hsa-miR-30a miR-30 Homo sapiens
UGUAAACAUCCUCGACUGGAAG
1001 picture button
hsa-miR-30c-2* miR-30* Homo sapiens
CUGGGAGAAGGCUGUUUACUCU
1019 picture button
hsa-miR-30a* miR-30* Homo sapiens
CUUUCAGUCGGAUGUUUGCAGC
1000 picture button
hsa-miR-30c miR-30 Homo sapiens
UGUAAACAUCCUACACUCUCAGC
1036 picture button
hsa-miR-30e* miR-30* Homo sapiens
CUUUCAGUCGGAUGUUUACAGC
959 picture button
hsa-miR-30c-1* miR-30* Homo sapiens
CUGGGAGAGGGUUGUUUACUCC
991 picture button
hsa-miR-30e miR-30 Homo sapiens
UGUAAACAUCCUUGACUGGAAG
1005 picture button
hsa-miR-30b miR-30 Homo sapiens
UGUAAACAUCCUACACUCAGCU
1040 picture button
hsa-miR-30d* miR-30* Homo sapiens
CUUUCAGUCAGAUGUUUGCUGC
988 picture button
hsa-miR-30b* miR-30* Homo sapiens
CUGGGAGGUGGAUGUUUACUUC
882 picture button
hsa-miR-31* miR-31* Homo sapiens
UGCUAUGCCAACAUAUUGCCAU
810 picture button
hsa-miR-31 miR-31 Homo sapiens
AGGCAAGAUGCUGGCAUAGCU
890 picture button
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
950 picture button
hsa-miR-32* miR-32* Homo sapiens
CAAUUUAGUGUGUGUGAUAUUU
527 picture button
hsa-miR-33b* miR-33* Homo sapiens
CAGUGCCUCGGCAGUGCAGCCC
800 picture button
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
1027 picture button
hsa-miR-33a* miR-33* Homo sapiens
CAAUGUUUCCACAGUGCAUCAC
732 picture button
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
1015 picture button
hsa-miR-34a* miR-34* Homo sapiens
CAAUCAGCAAGUAUACUGCCCU
954 picture button

Page 1 of 9
1 2 3 4 5 6 7 8 9 next >>

spacer
spacer