spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 7 of 7
<< prev 1 2 3 4 5 6 7

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-802 miR-802 Homo sapiens
CAGUAACAAAGAUUCAUCCUUGU
554 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
526 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
499 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
511 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
519 picture button
hsa-miR-873 miR-873 Homo sapiens
GCAGGAACUUGUGAGUCUCCU
633 picture button
hsa-miR-874 miR-874 Homo sapiens
CUGCCCUGGCCCGAGGGACCGA
590 picture button
hsa-miR-875-5p miR-875 Homo sapiens
UAUACCUCAGUUUUAUCAGGUG
665 picture button
hsa-miR-875-3p miR-875 Homo sapiens
CCUGGAAACACUGAGGUUGUG
626 picture button
hsa-miR-876-3p miR-876 Homo sapiens
UGGUGGUUUACAAAGUAAUUCA
586 picture button
hsa-miR-876-5p miR-876 Homo sapiens
UGGAUUUCUUUGUGAAUCACCA
621 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
415 picture button
mmu-miR-878-5p miR-878 Mus musculus
UAUCUAGUUGGAUGUCAAGACA
682 picture button
mmu-miR-878-3p miR-878 Mus musculus
GCAUGACACCACACUGGGUAGA
691 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
518 picture button
mmu-miR-880 miR-880 Mus musculus
UACUCCAUCCUCUCUGAGUAGA
531 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
532 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
383 picture button
mmu-miR-883a-5p miR-883 Mus musculus
UGCUGAGAGAAGUAGCAGUUAC
737 picture button
mmu-miR-883b-5p miR-883 Mus musculus
UACUGAGAAUGGGUAGCAGUCA
732 picture button
mmu-miR-883a-3p miR-883 Mus musculus
UAACUGCAACAGCUCUCAGUAU
756 picture button
mmu-miR-883b-3p miR-883 Mus musculus
UAACUGCAACAUCUCUCAGUAU
739 picture button
hsa-miR-885-3p miR-885 Homo sapiens
AGGCAGCGGGGUGUAGUGGAUA
576 picture button
hsa-miR-885-5p miR-885 Homo sapiens
UCCAUUACACUACCCUGCCUCU
694 picture button
hsa-miR-886-5p miR-886 Homo sapiens
CGGGUCGGAGUUAGCUCAAGCGG
665 picture button
hsa-miR-886-3p miR-886 Homo sapiens
CGCGGGUGCUUACUGACCCUU
679 picture button
hsa-miR-887 miR-887 Homo sapiens
GUGAACGGGCGCCAUCCCGAGG
556 picture button
hsa-miR-888 miR-888 Homo sapiens
UACUCAAAAAGCUGUCAGUCA
577 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
547 picture button
hsa-miR-890 miR-890 Homo sapiens
UACUUGGAAAGGCAUCAGUUG
620 picture button
hsa-miR-891a miR-891 Homo sapiens
UGCAACGAACCUGAGCCACUGA
708 picture button
hsa-miR-891b miR-891 Homo sapiens
UGCAACUUACCUGAGUCAUUGA
686 picture button
hsa-miR-892b miR-892 Homo sapiens
CACUGGCUCCUUUCUGGGUAGA
636 picture button
hsa-miR-892a miR-892 Homo sapiens
CACUGUGUCCUUUCUGCGUAG
620 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
520 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
476 picture button
hsa-miR-922 miR-922 Homo sapiens
GCAGCAGAGAAUAGGACUACGUC
537 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
509 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
474 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
523 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
548 picture button
hsa-miR-935 miR-935 Homo sapiens
CCAGUUACCGCUUCCGCUACCGC
612 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
554 picture button
hsa-miR-937 miR-937 Homo sapiens
AUCCGCGCUCUGACUCUCUGCC
639 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
585 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
518 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
514 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
501 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
410 picture button
hsa-miR-943 miR-943 Homo sapiens
CUGACUGUUGCCGUCCUCCAG
584 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
469 picture button

Page 7 of 7
<< prev 1 2 3 4 5 6 7

spacer
spacer