spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-558 miR-558 Homo sapiens
UGAGCUGCUGUACCAAAAU
526 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
371 picture button
hsa-miR-560 miR-560 Homo sapiens
GCGUGCGCCGGCCGGCCGCC
650 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
449 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
532 picture button
hsa-miR-563 miR-563 Homo sapiens
AGGUUGACAUACGUUUCCC
584 picture button
hsa-miR-564 miR-564 Homo sapiens
AGGCACGGUGUCAGCAGGC
572 picture button
hsa-miR-565 miR-565 Homo sapiens
GGCUGGCUCGCGAUGUCUGUUU
577 picture button
hsa-miR-566 miR-566 Homo sapiens
GGGCGCCUGUGAUCCCAAC
569 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
523 picture button
hsa-miR-568 miR-568 Homo sapiens
AUGUAUAAAUGUAUACACAC
534 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
478 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
396 picture button
hsa-miR-571 miR-571 Homo sapiens
UGAGUUGGCCAUCUGAGUGAG
560 picture button
hsa-miR-572 miR-572 Homo sapiens
GUCCGCUCGGCGGUGGCCCA
628 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
511 picture button
hsa-miR-574-5p miR-574 Homo sapiens
UGAGUGUGUGUGUGUGAGUGUGU
665 picture button
hsa-miR-574-3p miR-574 Homo sapiens
CACGCUCAUGCACACACCCACA
667 picture button
hsa-miR-575 miR-575 Homo sapiens
GAGCCAGUUGGACAGGAGC
598 picture button
hsa-miR-576-5p miR-576 Homo sapiens
AUUCUAAUUUCUCCACGUCUUU
608 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
607 picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
306 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
520 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
503 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
445 picture button
hsa-miR-581 miR-581 Homo sapiens
UCUUGUGUUCUCUAGAUCAGU
535 picture button
hsa-miR-582-5p miR-582 Homo sapiens
UUACAGUUGUUCAACCAGUUACU
616 picture button
hsa-miR-582-3p miR-582 Homo sapiens
UAACUGGUUGAACAACUGAACC
673 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
454 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
520 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
583 picture button
hsa-miR-586 miR-586 Homo sapiens
UAUGCAUUGUAUUUUUAGGUCC
526 picture button
hsa-miR-587 miR-587 Homo sapiens
UUUCCAUAGGUGAUGAGUCAC
611 picture button
hsa-miR-588 miR-588 Homo sapiens
UUGGCCACAAUGGGUUAGAAC
614 picture button
hsa-miR-589 miR-589 Homo sapiens
UGAGAACCACGUCUGCUCUGAG
638 picture button
hsa-miR-590-5p miR-590 Homo sapiens
GAGCUUAUUCAUAAAAGUGCAG
686 picture button
hsa-miR-590-3p miR-590 Homo sapiens
UAAUUUUAUGUAUAAGCUAGU
566 picture button
hsa-miR-591 miR-591 Homo sapiens
AGACCAUGGGUUCUCAUUGU
600 picture button
hsa-miR-592 miR-592 Homo sapiens
UUGUGUCAAUAUGCGAUGAUGU
553 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
506 picture button
hsa-miR-595 miR-595 Homo sapiens
GAAGUGUGCCGUGGUGUGUCU
545 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
580 picture button
hsa-miR-597 miR-597 Homo sapiens
UGUGUCACUCGAUGACCACUGU
571 picture button
hsa-miR-598 miR-598 Homo sapiens
UACGUCAUCGUUGUCAUCGUCA
635 picture button
hsa-miR-599 miR-599 Homo sapiens
GUUGUGUCAGUUUAUCAAAC
537 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
512 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
551 picture button
hsa-miR-602 miR-602 Homo sapiens
GACACGGGCGACAGCUGCGGCCC
595 picture button
hsa-miR-603 miR-603 Homo sapiens
CACACACUGCAAUUACUUUUGC
620 picture button
hsa-miR-604 miR-604 Homo sapiens
AGGCUGCGGAAUUCAGGAC
555 picture button
hsa-miR-605 miR-605 Homo sapiens
UAAAUCCCAUGGUGCCUUCUCCU
666 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
591 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
470 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
474 picture button
hsa-miR-609 miR-609 Homo sapiens
AGGGUGUUUCUCUCAUCUCU
558 picture button
hsa-miR-610 miR-610 Homo sapiens
UGAGCUAAAUGUGUGCUGGGA
562 picture button
hsa-miR-611 miR-611 Homo sapiens
GCGAGGACCCCUCGGGGUCUGAC
532 picture button
hsa-miR-612 miR-612 Homo sapiens
GCUGGGCAGGGCUUCUGAGCUCCUU
542 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
514 picture button
hsa-miR-614 miR-614 Homo sapiens
GAACGCCUGUUCUUGCCAGGUGG
590 picture button
hsa-miR-615-3p miR-615 Homo sapiens
UCCGAGCCUGGGUCUCCCUCUU
678 picture button
hsa-miR-615-5p miR-615 Homo sapiens
GGGGGUCCCCGGUGCUCGGAUC
738 picture button
hsa-miR-616 miR-616 Homo sapiens
AGUCAUUGGAGGGUUUGAGCAG
539 picture button
hsa-miR-617 miR-617 Homo sapiens
AGACUUCCCAUUUGAAGGUGGC
581 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
551 picture button
hsa-miR-619 miR-619 Homo sapiens
GACCUGGACAUGUUUGUGCCCAGU
626 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
458 picture button
hsa-miR-621 miR-621 Homo sapiens
GGCUAGCAACAGCGCUUACCU
579 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
618 picture button
hsa-miR-623 miR-623 Homo sapiens
AUCCCUUGCAGGGGCUGUUGGGU
560 picture button
hsa-miR-624 miR-624 Homo sapiens
CACAAGGUAUUGGUAUUACCU
616 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
385 picture button
hsa-miR-626 miR-626 Homo sapiens
AGCUGUCUGAAAAUGUCUU
543 picture button
hsa-miR-627 miR-627 Homo sapiens
GUGAGUCUCUAAGAAAAGAGGA
565 picture button
hsa-miR-628-5p miR-628 Homo sapiens
AUGCUGACAUAUUUACUAGAGG
709 picture button
hsa-miR-628-3p miR-628 Homo sapiens
UCUAGUAAGAGUGGCAGUCGA
625 picture button
hsa-miR-629 miR-629 Homo sapiens
UGGGUUUACGUUGGGAGAACU
536 picture button
hsa-miR-630 miR-630 Homo sapiens
AGUAUUCUGUACCAGGGAAGGU
544 picture button
hsa-miR-631 miR-631 Homo sapiens
AGACCUGGCCCAGACCUCAGC
544 picture button
hsa-miR-632 miR-632 Homo sapiens
GUGUCUGCUUCCUGUGGGA
615 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
465 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
604 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
515 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
489 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
517 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
548 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
539 picture button
hsa-miR-640 miR-640 Homo sapiens
AUGAUCCAGGAACCUGCCUCU
653 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
532 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
482 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
571 picture button
hsa-miR-644 miR-644 Homo sapiens
AGUGUGGCUUUCUUAGAGC
571 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
548 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
519 picture button
hsa-miR-647 miR-647 Homo sapiens
GUGGCUGCACUCACUUCCUUC
515 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
583 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
630 picture button
hsa-miR-650 miR-650 Homo sapiens
AGGAGGCAGCGCUCUCAGGAC
517 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
483 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
589 picture button

Page 5 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer