spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-492 miR-492 Homo sapiens
AGGACCUGCGGGACAAGAUUCUU
618 picture button
hsa-miR-493 miR-493 Homo sapiens
UGAAGGUCUACUGUGUGCCAGG
621 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
445 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
585 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
424 picture button
bta-miR-497 miR-497 Bos taurus
CAGCAGCACACUGUGGUUUGUA
521 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
635 picture button
gga-miR-499 miR-499 Gallus gallus
UUAAGACUUGUAGUGAUGUUUAG
549 picture button
hsa-miR-500 miR-500 Homo sapiens
UAAUCCUUGCUACCUGGGUGAGA
623 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
682 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
607 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
683 picture button
hsa-miR-502-5p miR-502 Homo sapiens
AUCCUUGCUAUCUGGGUGCUA
648 picture button
hsa-miR-503 miR-503 Homo sapiens
UAGCAGCGGGAACAGUUCUGCAG
507 picture button
hsa-miR-504 miR-504 Homo sapiens
AGACCCUGGUCUGCACUCUAUC
620 picture button
hsa-miR-505 miR-505 Homo sapiens
CGUCAACACUUGCUGGUUUCCU
583 picture button
hsa-miR-506 miR-506 Homo sapiens
UAAGGCACCCUUCUGAGUAGA
614 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
643 picture button
hsa-miR-508-5p miR-508 Homo sapiens
UACUCCAGAGGGCGUCACUCAUG
585 picture button
hsa-miR-508-3p miR-508 Homo sapiens
UGAUUGUAGCCUUUUGGAGUAGA
591 picture button
hsa-miR-509-5p miR-509 Homo sapiens
UACUGCAGACAGUGGCAAUCA
659 picture button
hsa-miR-509-3p miR-509 Homo sapiens
UGAUUGGUACGUCUGUGGGUAG
677 picture button
hsa-miR-509-3-5p miR-509 Homo sapiens
UACUGCAGACGUGGCAAUCAUG
623 picture button
hsa-miR-510 miR-510 Homo sapiens
UACUCAGGAGAGUGGCAAUCAC
544 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
508 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
616 picture button
hsa-miR-512-5p miR-512 Homo sapiens
CACUCAGCCUUGAGGGCACUUUC
678 picture button
hsa-miR-513-3p miR-513 Homo sapiens
UAAAUUUCACCUUUCUGAGAAGG
574 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
654 picture button
hsa-miR-514 miR-514 Homo sapiens
AUUGACACUUCUGUGAGUAGA
591 picture button
hsa-miR-515-3p miR-515 Homo sapiens
GAGUGCCUUCUUUUGGAGCGUU
687 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
737 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
709 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
662 picture button
hsa-miR-516b miR-516 Homo sapiens
AUCUGGAGGUAAGAAGCACUUU
645 picture button
hsa-miR-517a miR-517 Homo sapiens
AUCGUGCAUCCCUUUAGAGUGU
620 picture button
hsa-miR-517c miR-517 Homo sapiens
AUCGUGCAUCCUUUUAGAGUGU
642 picture button
hsa-miR-517b miR-517 Homo sapiens
UCGUGCAUCCCUUUAGAGUGUU
640 picture button
hsa-miR-518c miR-518 Homo sapiens
CAAAGCGCUUCUCUUUAGAGUGU
822 picture button
hsa-miR-518a-3p miR-518 Homo sapiens
GAAAGCGCUUCCCUUUGCUGGA
800 picture button
hsa-miR-518d-5p miR-518 Homo sapiens
CUCUAGAGGGAAGCACUUUCUG
779 picture button
hsa-miR-518b miR-518 Homo sapiens
CAAAGCGCUCCCCUUUAGAGGU
793 picture button
hsa-miR-518f miR-518 Homo sapiens
GAAAGCGCUUCUCUUUAGAGG
834 picture button
hsa-miR-518d-3p miR-518 Homo sapiens
CAAAGCGCUUCCCUUUGGAGC
772 picture button
hsa-miR-518a-5p miR-518 Homo sapiens
CUGCAAAGGGAAGCCCUUUC
767 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
768 picture button
hsa-miR-519d miR-519 Homo sapiens
CAAAGUGCCUCCCUUUAGAGUG
761 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
758 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
788 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
722 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
745 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
821 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
817 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
782 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
820 picture button
hsa-miR-520d-5p miR-520 Homo sapiens
CUACAAAGGGAAGCCCUUUC
769 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
805 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
780 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
847 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
776 picture button
hsa-miR-520a-5p miR-520 Homo sapiens
CUCCAGAGGGAAGUACUUUCU
809 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
532 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
548 picture button
hsa-miR-523 miR-523 Homo sapiens
GAACGCGCUUCCCUAUAGAGGGU
630 picture button
hsa-miR-524-5p miR-524 Homo sapiens
CUACAAAGGGAAGCACUUUCUC
629 picture button
hsa-miR-524-3p miR-524 Homo sapiens
GAAGGCGCUUCCCUUUGGAGU
647 picture button
hsa-miR-525-5p miR-525 Homo sapiens
CUCCAGAGGGAUGCACUUUCU
600 picture button
hsa-miR-525-3p miR-525 Homo sapiens
GAAGGCGCUUCCCUUUAGAGCG
676 picture button
hsa-miR-526b miR-526 Homo sapiens
CUCUUGAGGGAAGCACUUUCUGU
529 picture button
bta-miR-532 miR-532 Bos taurus
CAUGCCUUGAGUGUAGGACCGU
652 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
395 picture button
mmu-miR-540-5p miR-540 Mus musculus
CAAGGGUCACCCUCUGACUCUGU
641 picture button
mmu-miR-540-3p miR-540 Mus musculus
AGGUCAGAGGUCGAUCCUGG
633 picture button
hsa-miR-541 miR-541 Homo sapiens
UGGUGGGCACAGAAUCUGGACU
579 picture button
hsa-miR-542-5p miR-542 Homo sapiens
UCGGGGAUCAUCAUGUCACGAGA
603 picture button
hsa-miR-542-3p miR-542 Homo sapiens
UGUGACAGAUUGAUAACUGAAA
648 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
656 picture button
hsa-miR-544 miR-544 Homo sapiens
AUUCUGCAUUUUUAGCAAGUUC
531 picture button
bta-miR-545 miR-545 Bos taurus
AUCAACAAACAUUUAUUGUGUG
561 picture button
mmu-miR-546 miR-546 Mus musculus
AUGGUGGCACGGAGUC
606 picture button
mmu-miR-547 miR-547 Mus musculus
CUUGGUACAUCUUUGAGUGAG
570 picture button
hsa-miR-548a-3p miR-548 Homo sapiens
CAAAACUGGCAAUUACUUUUGC
840 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
676 picture button
hsa-miR-548b-3p miR-548 Homo sapiens
CAAGAACCUCAGUUGCUUUUGU
856 picture button
hsa-miR-548c-3p miR-548 Homo sapiens
CAAAAAUCUCAAUUACUUUUGC
811 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
620 picture button
hsa-miR-548d-3p miR-548 Homo sapiens
CAAAAACCACAGUUUCUUUUGC
763 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
696 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
673 picture button
hsa-miR-549 miR-549 Homo sapiens
UGACAACUAUGGAUGAGCUCU
595 picture button
hsa-miR-550 miR-550 Homo sapiens
AGUGCCUGAGGGAGUAAGAGCCC
542 picture button
hsa-miR-551b miR-551 Homo sapiens
GCGACCCAUACUUGGUUUCAG
557 picture button
hsa-miR-551a miR-551 Homo sapiens
GCGACCCACUCUUGGUUUCCA
573 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
545 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
601 picture button
hsa-miR-554 miR-554 Homo sapiens
GCUAGUCCUGACUCAGCCAGU
575 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
508 picture button
hsa-miR-556-5p miR-556 Homo sapiens
GAUGAGCUCAUUGUAAUAUGAG
693 picture button
hsa-miR-556-3p miR-556 Homo sapiens
AUAUUACCAUUAGCUCAUCUUU
684 picture button
hsa-miR-557 miR-557 Homo sapiens
GUUUGCACGGGUGGGCCUUGUCU
576 picture button

Page 4 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer