spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
687 picture button
gga-miR-153 miR-153 Gallus gallus
UUGCAUAGUCACAAAAGUGA
660 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
536 picture button
gga-miR-155 miR-155 Gallus gallus
UUAAUGCUAAUCGUGAUAGGGG
617 picture button
gga-miR-181b miR-181 Gallus gallus
AACAUUCAUUGCUGUCGGUGGG
744 picture button
gga-miR-181a miR-181 Gallus gallus
AACAUUCAACGCUGUCGGUGAGU
690 picture button
gga-miR-181a* miR-181* Gallus gallus
ACCAUCGACCGUUGAUUGUACC
630 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
678 picture button
gga-miR-183 miR-183 Gallus gallus
UAUGGCACUGGUAGAAUUCACUG
679 picture button
gga-miR-184 miR-184 Gallus gallus
UGGACGGAGAACUGAUAAGGGU
578 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
441 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
464 picture button
gga-miR-187 miR-187 Gallus gallus
UCGUGUCUUGUGUUGCAGCC
607 picture button
hsa-miR-188-3p miR-188 Homo sapiens
CUCCCACAUGCAGGGUUUGCA
711 picture button
hsa-miR-188-5p miR-188 Homo sapiens
CAUCCCUUGCAUGGUGGAGGG
612 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
639 picture button
gga-miR-190 miR-190 Gallus gallus
UGAUAUGUUUGAUAUAUUAGGU
589 picture button
bta-miR-191 miR-191 Bos taurus
CAACGGAAUCCCAAAAGCAGCUG
569 picture button
bta-miR-192 miR-192 Bos taurus
CUGACCUAUGAAUUGACAGCCAG
608 picture button
gga-miR-193 miR-193 Gallus gallus
AACUGGCCCACAAAGUCCCGCUUU
588 picture button
gga-miR-194 miR-194 Gallus gallus
UGUAACAGCAACUCCAUGUGGA
614 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
505 picture button
gga-miR-196 miR-196 Gallus gallus
UAGGUAGUUUCAUGUUGUUGG
610 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
611 picture button
hsa-miR-198 miR-198 Homo sapiens
GGUCCAGAGGGGAGAUAGGUUC
581 picture button
gga-miR-199* miR-199* Gallus gallus
UACAGUAGUCUGCACAUUGG
466 picture button
gga-miR-199 miR-199 Gallus gallus
CCCAGUGUUCAGACUACCUGUUC
650 picture button
gga-miR-200a miR-200 Gallus gallus
UAACACUGUCUGGUAACGAUGU
847 picture button
gga-miR-200b miR-200 Gallus gallus
UAAUACUGCCUGGUAAUGAUGAU
787 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
529 picture button
gga-miR-202 miR-202 Gallus gallus
AGAGGCAUAGAGCAUGGGAAAA
529 picture button
gga-miR-202* miR-202* Gallus gallus
UUUCCUAUGCAUAUACUUCUUU
466 picture button
gga-miR-203 miR-203 Gallus gallus
GUGAAAUGUUUAGGACCACUUG
515 picture button
gga-miR-204 miR-204 Gallus gallus
UUCCCUUUGUCAUCCUAUGCCU
490 picture button
gga-miR-205b miR-205 Gallus gallus
CCCUUCAUUCCACCGGAAUCUG
616 picture button
gga-miR-205a miR-205 Gallus gallus
UCCUUCAUUCCACCGGAGUCUG
620 picture button
gga-miR-206 miR-206 Gallus gallus
UGGAAUGUAAGGAAGUGUGUGG
559 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
452 picture button
hsa-miR-208 miR-208 Homo sapiens
AUAAGACGAGCAAAAAGCUUGU
584 picture button
hsa-miR-208b miR-208 Homo sapiens
AUAAGACGAACAAAAGGUUUGU
569 picture button
bta-miR-210 miR-210 Bos taurus
ACUGUGCGUGUGACAGCGGCUGA
591 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
460 picture button
hsa-miR-212 miR-212 Homo sapiens
UAACAGUCUCCAGUCACGGCC
742 picture button
bta-miR-214 miR-214 Bos taurus
ACAGCAGGCACAGACAGGCAGU
600 picture button
gga-miR-215 miR-215 Gallus gallus
AUGACCUAUGAAUUGACAGAC
590 picture button
gga-miR-216 miR-216 Gallus gallus
UAAUCUCAGCUGGCAACUGUG
730 picture button
gga-miR-217 miR-217 Gallus gallus
UACUGCAUCAGGAACUGAUUGGAU
640 picture button
gga-miR-218 miR-218 Gallus gallus
UUGUGCUUGAUCUAACCAUGU
564 picture button
gga-miR-219 miR-219 Gallus gallus
UGAUUGUCCAAACGCAAUUCU
753 picture button
hsa-miR-220 miR-220 Homo sapiens
CCACACCGUAUCUGACACUUU
810 picture button
hsa-miR-220c miR-220 Homo sapiens
ACACAGGGCUGUUGUGAAGACU
662 picture button
hsa-miR-220b miR-220 Homo sapiens
CCACCACCGUGUCUGACACUU
805 picture button
gga-miR-221 miR-221 Gallus gallus
AGCUACAUUGUCUGCUGGGUUUC
643 picture button
gga-miR-222 miR-222 Gallus gallus
AGCUACAUCUGGCUACUGGGUCUC
667 picture button
gga-miR-223 miR-223 Gallus gallus
UGUCAGUUUGUCAAAUACCCC
614 picture button
hsa-miR-224 miR-224 Homo sapiens
CAAGUCACUAGUGGUUCCGUU
630 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
640 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
682 picture button
mmu-miR-291b-5p miR-291 Mus musculus
GAUCAAAGUGGAGGCCCUCUCC
730 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
731 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
831 picture button
mmu-miR-291a-5p miR-291 Mus musculus
CAUCAAAGUGGAGGCCCUCUCU
721 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
681 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
666 picture button
mmu-miR-293 miR-293 Mus musculus
AGUGCCGCAGAGUUUGUAGUGU
560 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
594 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
579 picture button
hsa-miR-296-5p miR-296 Homo sapiens
AGGGCCCCCCCUCAAUCCUGU
701 picture button
hsa-miR-296-3p miR-296 Homo sapiens
GAGGGUUGGGUGGAGGCUCUCC
633 picture button
hsa-miR-297 miR-297 Homo sapiens
AUGUAUGUGUGCAUGUGCAUG
528 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
503 picture button
hsa-miR-299-3p miR-299 Homo sapiens
UAUGUGGGAUGGUAAACCGCUU
536 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
634 picture button
hsa-miR-300 miR-300 Homo sapiens
UAUACAAGGGCAGACUCUCUCU
541 picture button
gga-miR-301 miR-301 Gallus gallus
CAGUGCAAUAAUAUUGUCAAAGCAU
666 picture button
gga-miR-302b* miR-302* Gallus gallus
ACUUUAACAUGGAGGUGCUUUCU
581 picture button
gga-miR-302b miR-302 Gallus gallus
UAAGUGCUUCCAUGUUUUAGUAG
687 picture button
gga-miR-302d miR-302 Gallus gallus
UAAGUGCUUCCAUGUUUUAGUUG
711 picture button
gga-miR-302a miR-302 Gallus gallus
AAGUGCUUCCAUGUUUUAGUGA
680 picture button
gga-miR-302c* miR-302* Gallus gallus
UUUAACAUGGAGGUACCUGCUG
568 picture button
gga-miR-302c miR-302 Gallus gallus
UAAGUGCUUCCAUGUUUCAGUGG
703 picture button
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
577 picture button
mmu-miR-322 miR-322 Mus musculus
CAGCAGCAAUUCAUGUUUUGGA
500 picture button
hsa-miR-323-5p miR-323 Homo sapiens
AGGUGGUCCGUGGCGCGUUCGC
620 picture button
hsa-miR-323-3p miR-323 Homo sapiens
CACAUUACACGGUCGACCUCU
714 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
727 picture button
hsa-miR-324-5p miR-324 Homo sapiens
CGCAUCCCCUAGGGCAUUGGUGU
752 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
505 picture button
hsa-miR-326 miR-326 Homo sapiens
CCUCUGGGCCCUUCCUCCAG
542 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
525 picture button
hsa-miR-328 miR-328 Homo sapiens
CUGGCCCUCUCUGCCCUUCCGU
545 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
595 picture button
hsa-miR-330-3p miR-330 Homo sapiens
GCAAAGCACACGGCCUGCAGAGA
631 picture button
hsa-miR-330-5p miR-330 Homo sapiens
UCUCUGGGCCUGUGUCUUAGGC
569 picture button
bta-miR-331 miR-331 Bos taurus
GCCCCUGGGCCUAUCCUAGAA
595 picture button
rno-miR-333 miR-333 Rattus norvegicus
GUGGUGUGCUAGUUACUUUU
542 picture button
hsa-miR-335 miR-335 Homo sapiens
UCAAGAGCAAUAACGAAAAAUGU
604 picture button
rno-miR-336 miR-336 Rattus norvegicus
UCACCCUUCCAUAUCUAGUCU
559 picture button
hsa-miR-337-5p miR-337 Homo sapiens
GAACGGCUUCAUACAGGAGUU
716 picture button
hsa-miR-337-3p miR-337 Homo sapiens
CUCCUAUAUGAUGCCUUUCUUC
656 picture button

Page 2 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer