spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-577 miR-577 Homo sapiens
UAGAUAAAAUAUUGGUACCUG
306 picture button
hsa-miR-559 miR-559 Homo sapiens
UAAAGUAAAUAUGCACCAAAA
371 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
378 picture button
mmu-miR-882 miR-882 Mus musculus
AGGAGAGAGUUAGCGCAUUAGU
383 picture button
hsa-miR-625 miR-625 Homo sapiens
AGGGGGAAAGUUCUAUAGUCC
385 picture button
hsa-miR-539 miR-539 Homo sapiens
GGAGAAAUUAUCCUUGGUGUGU
395 picture button
hsa-miR-570 miR-570 Homo sapiens
CGAAAACAGCAAUUACCUUUGC
396 picture button
hsa-miR-942 miR-942 Homo sapiens
UCUUCUCUGUUUUGGCCAUGUG
410 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
411 picture button
hsa-miR-877 miR-877 Homo sapiens
GUAGAGGAGAUGGCGCAGGG
415 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
419 picture button
hsa-miR-496 miR-496 Homo sapiens
UGAGUAUUACAUGGCCAAUCUC
424 picture button
gga-miR-140* miR-140* Gallus gallus
CCACAGGGUAGAACCACGGAC
427 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
441 picture button
hsa-miR-494 miR-494 Homo sapiens
UGAAACAUACACGGGAAACCUC
445 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
445 picture button
hsa-miR-561 miR-561 Homo sapiens
CAAAGUUUAAGAUCCUUGAAGU
449 picture button
mmu-miR-207 miR-207 Mus musculus
GCUUCUCCUGGCUCUCCUCCCUC
452 picture button
gga-miR-126* miR-126* Gallus gallus
CAUUAUUACUUUUGGUACGCG
454 picture button
hsa-miR-583 miR-583 Homo sapiens
CAAAGAGGAAGGUCCCAUUAC
454 picture button
hsa-miR-620 miR-620 Homo sapiens
AUGGAGAUAGAUAUAGAAAU
458 picture button
hsa-miR-760 miR-760 Homo sapiens
CGGCUCUGGGUCUGUGGGGA
459 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
460 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
461 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
464 picture button
bta-miR-374 miR-374 Bos taurus
UUAUAAUACAACCUGAUAAGUG
465 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
465 picture button
gga-miR-199* miR-199* Gallus gallus
UACAGUAGUCUGCACAUUGG
466 picture button
gga-miR-202* miR-202* Gallus gallus
UUUCCUAUGCAUAUACUUCUUU
466 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
467 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
469 picture button
hsa-miR-607 miR-607 Homo sapiens
GUUCAAAUCCAGAUCUAUAAC
470 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
472 picture button
hsa-miR-608 miR-608 Homo sapiens
AGGGGUGGUGUUGGGACAGCUCCGU
474 picture button
hsa-miR-924 miR-924 Homo sapiens
AGAGUCUUGUGAUGUCUUGC
474 picture button
hsa-miR-921 miR-921 Homo sapiens
CUAGUGAGGGACAGAACCAGGAUUC
476 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
477 picture button
hsa-miR-569 miR-569 Homo sapiens
AGUUAAUGAAUCCUGGAAAGU
478 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
478 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
482 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
483 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
485 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
488 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
489 picture button
gga-miR-204 miR-204 Gallus gallus
UUCCCUUUGUCAUCCUAUGCCU
490 picture button
mmu-miR-699 miR-699 Mus musculus
AGGCAGUGCGACCUGGCUCG
498 picture button
mmu-miR-805 miR-805 Mus musculus
GAAUUGAUCAGGACAUAGGG
499 picture button
mmu-miR-322 miR-322 Mus musculus
CAGCAGCAAUUCAUGUUUUGGA
500 picture button
mmu-miR-683 miR-683 Mus musculus
CCUGCUGUAAGCUGUGUCCUC
500 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
500 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
500 picture button
rno-miR-664 miR-664 Rattus norvegicus
UAUUCAUUUACUCCCCAGCCUA
501 picture button
hsa-miR-941 miR-941 Homo sapiens
CACCCGGCUGUGUGCACAUGUGC
501 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
502 picture button
hsa-miR-298 miR-298 Homo sapiens
AGCAGAAGCAGGGAGGUUCUCCCA
503 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
503 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
503 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
505 picture button
hsa-miR-325 miR-325 Homo sapiens
CCUAGUAGGUGUCCAGUAAGUGU
505 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
506 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
506 picture button
hsa-miR-503 miR-503 Homo sapiens
UAGCAGCGGGAACAGUUCUGCAG
507 picture button
hsa-miR-511 miR-511 Homo sapiens
GUGUCUUUUGCUCUGCAGUCA
508 picture button
hsa-miR-555 miR-555 Homo sapiens
AGGGUAAGCUGAACCUCUGAU
508 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
508 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
509 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
509 picture button
hsa-miR-923 miR-923 Homo sapiens
GUCAGCGGAGGAAAAGAAACU
509 picture button
hsa-miR-573 miR-573 Homo sapiens
CUGAAGUGAUGUGUAACUGAUCAG
511 picture button
hsa-miR-871 miR-871 Homo sapiens
UAUUCAGAUUAGUGCCAGUCAUG
511 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
512 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
513 picture button
hsa-miR-613 miR-613 Homo sapiens
AGGAAUGUUCCUUCUUUGCC
514 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
514 picture button
gga-miR-203 miR-203 Gallus gallus
GUGAAAUGUUUAGGACCACUUG
515 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
515 picture button
hsa-miR-647 miR-647 Homo sapiens
GUGGCUGCACUCACUUCCUUC
515 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
517 picture button
hsa-miR-650 miR-650 Homo sapiens
AGGAGGCAGCGCUCUCAGGAC
517 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
517 picture button
mmu-miR-879 miR-879 Mus musculus
AGAGGCUUAUAGCUCUAAGCC
518 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
518 picture button
gga-miR-16 miR-16 Gallus gallus
UAGCAGCACGUAAAUAUUGGUG
519 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
519 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
519 picture button
hsa-miR-578 miR-578 Homo sapiens
CUUCUUGUGCUCUAGGAUUGU
520 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
520 picture button
hsa-miR-672 miR-672 Homo sapiens
UGAGGUUGGUGUACUGUGUGUGA
520 picture button
hsa-miR-920 miR-920 Homo sapiens
GGGGAGCUGUGGAAGCAGUA
520 picture button
bta-miR-497 miR-497 Bos taurus
CAGCAGCACACUGUGGUUUGUA
521 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
522 picture button
hsa-miR-567 miR-567 Homo sapiens
AGUAUGUUCUUCCAGGACAGAAC
523 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
523 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
523 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
523 picture button
gga-miR-146b* miR-146* Gallus gallus
CCCUAUGGAUUCAGUUCUGC
524 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
525 picture button
mmu-miR-463 miR-463 Mus musculus
UGAUAGACACCAUAUAAGGUAG
525 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
525 picture button
hsa-miR-370 miR-370 Homo sapiens
GCCUGCUGGGGUGGAACCUGGU
526 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer