spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
649 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
601 picture button
bta-miR-320 miR-320 Bos taurus
AAAAGCUGGGUUGAGAGGGCGA
577 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
620 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
676 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
673 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
696 picture button
gga-miR-106 miR-106 Gallus gallus
AAAAGUGCUUACAGUGCAGGUA
707 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
548 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
585 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
656 picture button
gga-miR-451 miR-451 Gallus gallus
AAACCGUUACCAUUACUGAGUUU
676 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
630 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
591 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
551 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
532 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
768 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
500 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
532 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
831 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
745 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
758 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
788 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
666 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
682 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
579 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
577 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
731 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
820 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
594 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
805 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
817 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
821 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
847 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
469 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
695 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
689 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
595 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
545 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
613 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
616 picture button
gga-miR-181a miR-181 Gallus gallus
AACAUUCAACGCUGUCGGUGAGU
690 picture button
gga-miR-181b miR-181 Gallus gallus
AACAUUCAUUGCUGUCGGUGGG
744 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
604 picture button
gga-miR-100 miR-100 Gallus gallus
AACCCGUAGAUCCGAACUUGUG
611 picture button
gga-miR-99a miR-99 Gallus gallus
AACCCGUAGAUCCGAUCUUGUG
663 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
532 picture button
gga-miR-193 miR-193 Gallus gallus
AACUGGCCCACAAAGUCCCGCUUU
588 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
532 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
583 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
578 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
607 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
519 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
633 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
580 picture button
bta-miR-423 miR-423 Bos taurus
AAGCUCGGUCUGAGGCCCCUCAGU
529 picture button
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
537 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
485 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
514 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
519 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
672 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
722 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
616 picture button
gga-miR-302a miR-302 Gallus gallus
AAGUGCUUCCAUGUUUUAGUGA
680 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
780 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
583 picture button
bta-miR-369-3p miR-369 Bos taurus
AAUAAUACAUGGUUGAUCUUU
680 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
526 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
478 picture button
bta-miR-487a miR-487 Bos taurus
AAUCAUACAGGGACAUCCAGU
603 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
661 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
607 picture button
bta-miR-487b miR-487 Bos taurus
AAUCGUACAGGGUCAUCCACUU
622 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
682 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
683 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
589 picture button
gga-miR-367 miR-367 Gallus gallus
AAUUGCACUUUAGCAAUGGUG
695 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
776 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
782 picture button
hsa-miR-220c miR-220 Homo sapiens
ACACAGGGCUGUUGUGAAGACU
662 picture button
bta-miR-214 miR-214 Bos taurus
ACAGCAGGCACAGACAGGCAGU
600 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
554 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
618 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
533 picture button
gga-miR-181a* miR-181* Gallus gallus
ACCAUCGACCGUUGAUUGUACC
630 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
640 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
681 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
701 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
624 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
534 picture button
gga-miR-17-3p miR-17 Gallus gallus
ACUGCAGUGAAGGCACUUGU
645 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
727 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
625 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
599 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
517 picture button
bta-miR-210 miR-210 Bos taurus
ACUGUGCGUGUGACAGCGGCUGA
591 picture button
hsa-miR-600 miR-600 Homo sapiens
ACUUACAGACAAGAGCCUUGCUC
512 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
588 picture button
mmu-miR-327 miR-327 Mus musculus
ACUUGAGGGGCAUGAGGAU
525 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
515 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer