spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
gga-let-7d let-7 Gallus gallus
AGAGGUAGUGGGUUGCAUAGU
670 picture button
gga-let-7a let-7 Gallus gallus
UGAGGUAGUAGGUUGUAUAGUU
711 picture button
gga-let-7g let-7 Gallus gallus
UGAGGUAGUAGUUUGUACAGU
712 picture button
gga-let-7c let-7 Gallus gallus
UGAGGUAGUAGGUUGUAUGGUU
705 picture button
gga-let-7k let-7 Gallus gallus
UGAGGUAGUAGAUUGAAUAGUU
652 picture button
gga-let-7f let-7 Gallus gallus
UGAGGUAGUAGAUUGUAUAGUU
701 picture button
gga-let-7b let-7 Gallus gallus
UGAGGUAGUAGGUUGUGUGGUU
712 picture button
gga-let-7i let-7 Gallus gallus
UGAGGUAGUAGUUUGUGCUGU
698 picture button
gga-miR-1a miR-1 Gallus gallus
UGGAAUGUAAAGAAGUAUGUA
582 picture button
gga-miR-1b miR-1 Gallus gallus
UGGAAUGUUAAGAAGUAUGUA
561 picture button
gga-miR-10b miR-10 Gallus gallus
UACCCUGUAGAACCGAAUUUGU
661 picture button
gga-miR-100 miR-100 Gallus gallus
AACCCGUAGAUCCGAACUUGUG
611 picture button
gga-miR-101 miR-101 Gallus gallus
UACAGUACUGUGAUAACUGAAG
741 picture button
gga-miR-103 miR-103 Gallus gallus
AGCAGCAUUGUACAGGGCUAUGA
556 picture button
hsa-miR-105 miR-105 Homo sapiens
UCAAAUGCUCAGACUCCUGUGGU
619 picture button
gga-miR-106 miR-106 Gallus gallus
AAAAGUGCUUACAGUGCAGGUA
707 picture button
gga-miR-107 miR-107 Gallus gallus
AGCAGCAUUGUACAGGGCUAUCA
576 picture button
gga-miR-122 miR-122 Gallus gallus
UGGAGUGUGACAAUGGUGUUUGU
592 picture button
gga-miR-124b miR-124 Gallus gallus
UUAAGGCACGCAGUGAAUGCCA
591 picture button
gga-miR-124a miR-124 Gallus gallus
UUAAGGCACGCGGUGAAUGCCA
616 picture button
gga-miR-125b miR-125 Gallus gallus
UCCCUGAGACCCUAACUUGUGA
714 picture button
gga-miR-126 miR-126 Gallus gallus
UCGUACCGUGAGUAAUAAUGCGC
593 picture button
gga-miR-126* miR-126* Gallus gallus
CAUUAUUACUUUUGGUACGCG
454 picture button
bta-miR-127 miR-127 Bos taurus
UCGGAUCCGUCUGAGCUUGGCU
534 picture button
gga-miR-128 miR-128 Gallus gallus
UCACAGUGAACCGGUCUCUUU
695 picture button
hsa-miR-129-5p miR-129 Homo sapiens
CUUUUUGCGGUCUGGGCUUGC
593 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
633 picture button
gga-miR-130a miR-130 Gallus gallus
CAGUGCAAUAUUAAAAGGGCAU
691 picture button
gga-miR-130b miR-130 Gallus gallus
CAGUGCAAUAAUGAAAGGGCGU
704 picture button
bta-miR-132 miR-132 Bos taurus
UAACAGUCUACAGCCAUGGUCG
742 picture button
gga-miR-133c miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUGC
622 picture button
gga-miR-133b miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUA
625 picture button
gga-miR-133a miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUGU
644 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
622 picture button
gga-miR-135a miR-135 Gallus gallus
UAUGGCUUUUUAUUCCUAUGUGA
685 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
534 picture button
gga-miR-137 miR-137 Gallus gallus
UAUUGCUUAAGAAUACGCGUAG
609 picture button
gga-miR-138 miR-138 Gallus gallus
AGCUGGUGUUGUGAAUC
612 picture button
bta-miR-139 miR-139 Bos taurus
UCUACAGUGCACGUGUCUCCAGU
658 picture button
gga-miR-140 miR-140 Gallus gallus
AGUGGUUUUACCCUAUGGUAG
596 picture button
gga-miR-140* miR-140* Gallus gallus
CCACAGGGUAGAACCACGGAC
427 picture button
hsa-miR-141 miR-141 Homo sapiens
UAACACUGUCUGGUAAAGAUGG
761 picture button
gga-miR-142-5p miR-142 Gallus gallus
CCCAUAAAGUAGAAAGCACUAC
639 picture button
gga-miR-142-3p miR-142 Gallus gallus
UGUAGUGUUUCCUACUUUAUGG
686 picture button
hsa-miR-143 miR-143 Homo sapiens
UGAGAUGAAGCACUGUAGCUC
596 picture button
gga-miR-144 miR-144 Gallus gallus
CUACAGUAUAGAUGAUGUACUC
660 picture button
bta-miR-145 miR-145 Bos taurus
GUCCAGUUUUCCCAGGAAUCCCU
612 picture button
gga-miR-146b miR-146 Gallus gallus
UGAGAACUGAAUUCCAUAGGCG
631 picture button
gga-miR-146a miR-146 Gallus gallus
UGAGAACUGAAUUCCAUGGGUU
614 picture button
gga-miR-146b* miR-146* Gallus gallus
CCCUAUGGAUUCAGUUCUGC
524 picture button
gga-miR-147 miR-147 Gallus gallus
GUGUGCGGAAAUGCUUCUGC
598 picture button
gga-miR-148a miR-148 Gallus gallus
UCAGUGCACUACAGAACUUUGU
697 picture button
hsa-miR-149 miR-149 Homo sapiens
UCUGGCUCCGUGUCUUCACUCCC
513 picture button
gga-miR-15a miR-15 Gallus gallus
UAGCAGCACAUAAUGGUUUGU
617 picture button
gga-miR-15b miR-15 Gallus gallus
UAGCAGCACAUCAUGGUUUGCA
633 picture button
bta-miR-150 miR-150 Bos taurus
UCUCCCAACCCUUGUACCAGUGU
579 picture button
bta-miR-151 miR-151 Bos taurus
CUAGACUGAAGCUCCUUGAGG
563 picture button
hsa-miR-152 miR-152 Homo sapiens
UCAGUGCAUGACAGAACUUGG
687 picture button
gga-miR-153 miR-153 Gallus gallus
UUGCAUAGUCACAAAAGUGA
660 picture button
hsa-miR-154 miR-154 Homo sapiens
UAGGUUAUCCGUGUUGCCUUCG
536 picture button
gga-miR-155 miR-155 Gallus gallus
UUAAUGCUAAUCGUGAUAGGGG
617 picture button
gga-miR-16 miR-16 Gallus gallus
UAGCAGCACGUAAAUAUUGGUG
519 picture button
gga-miR-17-5p miR-17 Gallus gallus
CAAAGUGCUUACAGUGCAGGUAGU
755 picture button
gga-miR-17-3p miR-17 Gallus gallus
ACUGCAGUGAAGGCACUUGU
645 picture button
gga-miR-18a miR-18 Gallus gallus
UAAGGUGCAUCUAGUGCAGAUA
643 picture button
gga-miR-18b miR-18 Gallus gallus
UAAGGUGCAUCUAGUGCAGUUA
641 picture button
gga-miR-181b miR-181 Gallus gallus
AACAUUCAUUGCUGUCGGUGGG
744 picture button
gga-miR-181a miR-181 Gallus gallus
AACAUUCAACGCUGUCGGUGAGU
690 picture button
gga-miR-181a* miR-181* Gallus gallus
ACCAUCGACCGUUGAUUGUACC
630 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
678 picture button
gga-miR-183 miR-183 Gallus gallus
UAUGGCACUGGUAGAAUUCACUG
679 picture button
gga-miR-184 miR-184 Gallus gallus
UGGACGGAGAACUGAUAAGGGU
578 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
441 picture button
bta-miR-186 miR-186 Bos taurus
CAAAGAAUUCUCCUUUUGGGCU
464 picture button
gga-miR-187 miR-187 Gallus gallus
UCGUGUCUUGUGUUGCAGCC
607 picture button
hsa-miR-188-3p miR-188 Homo sapiens
CUCCCACAUGCAGGGUUUGCA
711 picture button
hsa-miR-188-5p miR-188 Homo sapiens
CAUCCCUUGCAUGGUGGAGGG
612 picture button
mml-miR-189 miR-189 Macaca mulatta
GUGCCUACUGAGCUGAUAUCAGU
639 picture button
gga-miR-19b miR-19 Gallus gallus
UGUGCAAAUCCAUGCAAAACUGA
662 picture button
gga-miR-19a miR-19 Gallus gallus
UGUGCAAAUCUAUGCAAAACUGA
677 picture button
gga-miR-190 miR-190 Gallus gallus
UGAUAUGUUUGAUAUAUUAGGU
589 picture button
bta-miR-191 miR-191 Bos taurus
CAACGGAAUCCCAAAAGCAGCUG
569 picture button
bta-miR-192 miR-192 Bos taurus
CUGACCUAUGAAUUGACAGCCAG
608 picture button
gga-miR-193 miR-193 Gallus gallus
AACUGGCCCACAAAGUCCCGCUUU
588 picture button
gga-miR-194 miR-194 Gallus gallus
UGUAACAGCAACUCCAUGUGGA
614 picture button
bta-miR-195 miR-195 Bos taurus
UAGCAGCACAGAAAUAUUGGCA
505 picture button
gga-miR-196 miR-196 Gallus gallus
UAGGUAGUUUCAUGUUGUUGG
610 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
611 picture button
hsa-miR-198 miR-198 Homo sapiens
GGUCCAGAGGGGAGAUAGGUUC
581 picture button
gga-miR-199 miR-199 Gallus gallus
CCCAGUGUUCAGACUACCUGUUC
650 picture button
gga-miR-199* miR-199* Gallus gallus
UACAGUAGUCUGCACAUUGG
466 picture button
gga-miR-20a miR-20 Gallus gallus
UAAAGUGCUUAUAGUGCAGGUAG
750 picture button
gga-miR-20b miR-20 Gallus gallus
CAAAGUGCUCAUAGUGCAGGUAG
705 picture button
gga-miR-200a miR-200 Gallus gallus
UAACACUGUCUGGUAACGAUGU
847 picture button
gga-miR-200b miR-200 Gallus gallus
UAAUACUGCCUGGUAAUGAUGAU
787 picture button
mmu-miR-201 miR-201 Mus musculus
UACUCAGUAAGGCAUUGUUCUU
529 picture button
gga-miR-202 miR-202 Gallus gallus
AGAGGCAUAGAGCAUGGGAAAA
529 picture button
gga-miR-202* miR-202* Gallus gallus
UUUCCUAUGCAUAUACUUCUUU
466 picture button
gga-miR-203 miR-203 Gallus gallus
GUGAAAUGUUUAGGACCACUUG
515 picture button
gga-miR-204 miR-204 Gallus gallus
UUCCCUUUGUCAUCCUAUGCCU
490 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer