spacer

MicroRNA Listing for Takifugu rubripes


173 microRNAs (109 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
867 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
789 picture button
dre-miR-451 miR-451 Danio rerio
AAACCGUUACCAUUACUGAGUU
783 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
870 picture button
dre-miR-430b miR-430 Danio rerio
AAAGUGCUAUCAAGUUGGGGUAG
892 picture button
fru-miR-216a miR-216 Takifugu rubripes
AAAUCUCAGCUGGCAACUGUGA
913 picture button
fru-miR-181a miR-181 Takifugu rubripes
AACAUUCAACGCUGUCGGUGAGU
982 picture button
fru-miR-181b miR-181 Takifugu rubripes
AACAUUCAUUGCUGUCGGUGGG
991 picture button
fru-miR-100 miR-100 Takifugu rubripes
AACCCGUAGAUCCGAACUUGUG
703 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
723 picture button
fru-miR-193 miR-193 Takifugu rubripes
AACUGGCCUACAAAGUCCCAGU
798 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
661 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
650 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
661 picture button
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
814 picture button
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
808 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
583 picture button
xtr-miR-425-5p miR-425 Xenopus tropicalis
AAUGACACGAUCACUCCCGUUGA
776 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
685 picture button
dre-miR-363 miR-363 Danio rerio
AAUUGCACGGUAUCCAUCUGUA
806 picture button
xtr-miR-367 miR-367 Xenopus tropicalis
AAUUGCACUGUAGCAAUGGUGA
846 picture button
fru-miR-214 miR-214 Takifugu rubripes
ACAGCAGGCACAGACAGGCAG
651 picture button
fru-miR-181a* miR-181* Takifugu rubripes
ACCAUCGACCGUUGAUUGUACC
711 picture button
fru-miR-202 miR-202 Takifugu rubripes
AGAGGCAUAGGGCAUGGGAAAA
688 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
768 picture button
fru-miR-107 miR-107 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUCA
733 picture button
fru-miR-103 miR-103 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUGA
723 picture button
fru-miR-222 miR-222 Takifugu rubripes
AGCUACAUCUGGCUACUGGGUCUC
817 picture button
fru-miR-221 miR-221 Takifugu rubripes
AGCUACAUUGUCUGCUGGGUUUC
807 picture button
fru-miR-138 miR-138 Takifugu rubripes
AGCUGGUGUUGUGAAUCAGGCC
661 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
786 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
669 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
647 picture button
fru-miR-489 miR-489 Takifugu rubripes
AGUGACAUCAUAUGUACGGCUGC
775 picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
457 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
634 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
635 picture button
fru-miR-458 miR-458 Takifugu rubripes
AUAGCUCUUUAAAUGGUACUGC
607 picture button
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
799 picture button
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
769 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
676 picture button
fru-miR-192 miR-192 Takifugu rubripes
AUGACCUAUGAAUUGACAGCC
741 picture button
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
893 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
730 picture button
fru-miR-460 miR-460 Takifugu rubripes
CACAGCGCAUACAAUGUGGAUG
806 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
697 picture button
fru-miR-301 miR-301 Takifugu rubripes
CAGUGCAAUAGUAUUGUCAUAG
795 picture button
fru-miR-130 miR-130 Takifugu rubripes
CAGUGCAAUAUUAAAAGGGCAU
818 picture button
fru-miR-140 miR-140 Takifugu rubripes
CAGUGGUUUUACCCUAUGGUAG
743 picture button
fru-miR-142a miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACU
540 picture button
fru-miR-142b miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACUA
562 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
595 picture button
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
797 picture button
dre-miR-220 miR-220 Danio rerio
CCACAACCGUAUCGGACACUU
774 picture button
fru-miR-199 miR-199 Takifugu rubripes
CCCAGUGUUCAGACUACCUGUUC
855 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
697 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
740 picture button
fru-miR-210 miR-210 Takifugu rubripes
CUGUGCGUGUGACAGCGGCUAA
780 picture button
fru-miR-129 miR-129 Takifugu rubripes
CUUUUUGCGGUCUGGGCUUGCU
657 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
693 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
670 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
651 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
550 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
864 picture button
fru-miR-203 miR-203 Takifugu rubripes
GUGAAAUGUUUAGGACCACUUG
628 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
781 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
807 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
714 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
590 picture button
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
845 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
944 picture button
fru-miR-200a miR-200 Takifugu rubripes
UAACACUGUCUGGUAACGAUGU
1050 picture button
fru-miR-132 miR-132 Takifugu rubripes
UAACAGUCUACAGCCAUGGUCG
872 picture button
fru-miR-212 miR-212 Takifugu rubripes
UAACAGUCUACAGUCAUGGCU
883 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
601 picture button
fru-miR-124 miR-124 Takifugu rubripes
UAAGGCACGCGGUGAAUGCCAA
813 picture button
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
740 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
872 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
890 picture button
xtr-miR-302 miR-302 Xenopus tropicalis
UAAGUGCUCCAAUGUUUUAGUGG
839 picture button
xtr-miR-428 miR-428 Xenopus tropicalis
UAAGUGCUCUCUAGUUCGGUUG
799 picture button
dre-miR-430c miR-430 Danio rerio
UAAGUGCUUCUCUUUGGGGUAG
863 picture button
fru-miR-200b miR-200 Takifugu rubripes
UAAUACUGCCUGGUAAUGAUGA
1006 picture button
fru-miR-429 miR-429 Takifugu rubripes
UAAUACUGUCUGGUAAUGCCGU
854 picture button
fru-miR-216b miR-216 Takifugu rubripes
UAAUCUCUGCAGGCAACUGUGA
875 picture button
fru-miR-365 miR-365 Takifugu rubripes
UAAUGCCCCUAAAAAUCCUUAU
759 picture button
fru-miR-101b miR-101 Takifugu rubripes
UACAGUACUAUGAUAACUGAAG
820 picture button
fru-miR-101a miR-101 Takifugu rubripes
UACAGUACUGUGAUAACUGAAG
841 picture button
fru-miR-144 miR-144 Takifugu rubripes
UACAGUAUAGAUGAUGUACU
862 picture button
fru-miR-10d miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUGUGUGUG
842 picture button
fru-miR-10b miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUUUGUG
871 picture button
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
851 picture button
fru-miR-217 miR-217 Takifugu rubripes
UACUGCAUCAGGAACUGAUUGG
781 picture button
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
860 picture button
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
839 picture button
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
802 picture button
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
689 picture button
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
764 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
787 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
837 picture button

Page 1 of 2
1 2 next >>

spacer
spacer