spacer

MicroRNA Listing for Takifugu rubripes


173 microRNAs (109 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
844 picture button
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
844 picture button
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
750 picture button
fru-let-7b let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUGUGGUU
819 picture button
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
791 picture button
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
780 picture button
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
785 picture button
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
814 picture button
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
615 picture button
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
696 picture button
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
652 picture button
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
851 picture button
fru-miR-10b miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUUUGUG
871 picture button
fru-miR-10d miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUGUGUGUG
842 picture button
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
764 picture button
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
802 picture button
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
689 picture button
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
893 picture button
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
740 picture button
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
798 picture button
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
825 picture button
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
845 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
787 picture button
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
808 picture button
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
814 picture button
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
799 picture button
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
769 picture button
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
780 picture button
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
797 picture button
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
819 picture button
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
879 picture button
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
858 picture button
fru-miR-27e miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCAGUG
867 picture button
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
860 picture button
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
839 picture button
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
825 picture button
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
831 picture button
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
812 picture button
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
670 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
807 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
781 picture button
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
824 picture button
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
786 picture button
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
837 picture button
fru-miR-92 miR-92 Takifugu rubripes
UAUUGCACUUGUCCCGGCCUGU
844 picture button
dre-miR-93 miR-93 Danio rerio
AAAAGUGCUGUUUGUGCAGGUA
867 picture button
fru-miR-96 miR-96 Takifugu rubripes
UUUGGCACUAGCACAUUUUUGCU
797 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
605 picture button
dre-miR-99 miR-99 Danio rerio
AACCCGUAGAUCCGAUCUUGUG
723 picture button
fru-miR-100 miR-100 Takifugu rubripes
AACCCGUAGAUCCGAACUUGUG
703 picture button
fru-miR-101b miR-101 Takifugu rubripes
UACAGUACUAUGAUAACUGAAG
820 picture button
fru-miR-101a miR-101 Takifugu rubripes
UACAGUACUGUGAUAACUGAAG
841 picture button
fru-miR-103 miR-103 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUGA
723 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
789 picture button
fru-miR-107 miR-107 Takifugu rubripes
AGCAGCAUUGUACAGGGCUAUCA
733 picture button
fru-miR-122 miR-122 Takifugu rubripes
UGGAGUGUGACAAUGGUGUUUG
654 picture button
fru-miR-124 miR-124 Takifugu rubripes
UAAGGCACGCGGUGAAUGCCAA
813 picture button
fru-miR-125a miR-125 Takifugu rubripes
UCCCUGAGACCCUUAACCUGUG
840 picture button
fru-miR-125b miR-125 Takifugu rubripes
UCCCUGAGACCCUAACUUGUGA
854 picture button
fru-miR-126 miR-126 Takifugu rubripes
UCGUACCGUGAGUAAUAAUGC
692 picture button
fru-miR-128 miR-128 Takifugu rubripes
UCACAGUGAACCGGUCUCUUUU
771 picture button
fru-miR-129 miR-129 Takifugu rubripes
CUUUUUGCGGUCUGGGCUUGCU
657 picture button
fru-miR-130 miR-130 Takifugu rubripes
CAGUGCAAUAUUAAAAGGGCAU
818 picture button
fru-miR-132 miR-132 Takifugu rubripes
UAACAGUCUACAGCCAUGGUCG
872 picture button
fru-miR-133 miR-133 Takifugu rubripes
UUUGGUCCCCUUCAACCAGCUG
788 picture button
fru-miR-135a miR-135 Takifugu rubripes
UAUGGCUUUCUAUUCCUAUGUG
785 picture button
fru-miR-135b miR-135 Takifugu rubripes
UAUGGCUUUUUAUUCCUAUCUG
743 picture button
fru-miR-137 miR-137 Takifugu rubripes
UUAUUGCUUAAGAAUACGCGUA
770 picture button
fru-miR-138 miR-138 Takifugu rubripes
AGCUGGUGUUGUGAAUCAGGCC
661 picture button
dre-miR-139 miR-139 Danio rerio
UCUACAGUGCAUGUGUCU
794 picture button
fru-miR-140 miR-140 Takifugu rubripes
CAGUGGUUUUACCCUAUGGUAG
743 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
944 picture button
fru-miR-142b miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACUA
562 picture button
fru-miR-142a miR-142 Takifugu rubripes
CAUAAAGUAGAAAGCACUACU
540 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
618 picture button
fru-miR-144 miR-144 Takifugu rubripes
UACAGUAUAGAUGAUGUACU
862 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
864 picture button
dre-miR-146b miR-146 Danio rerio
UGAGAACUGAAUUCCAAGGGUG
794 picture button
dre-miR-146a miR-146 Danio rerio
UGAGAACUGAAUUCCAUAGAUGG
823 picture button
fru-miR-148 miR-148 Takifugu rubripes
UCAGUGCAUUACAGAACUUUGU
853 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
743 picture button
fru-miR-152 miR-152 Takifugu rubripes
UCAGUGCAUAACAGAACUUUGU
848 picture button
fru-miR-153a miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAGUGAUC
779 picture button
fru-miR-153b miR-153 Takifugu rubripes
UUGCAUAGUCACAAAAAUGAGC
773 picture button
dre-miR-155 miR-155 Danio rerio
UUAAUGCUAAUCGUGAUAGGGG
761 picture button
fru-miR-181a* miR-181* Takifugu rubripes
ACCAUCGACCGUUGAUUGUACC
711 picture button
fru-miR-181b miR-181 Takifugu rubripes
AACAUUCAUUGCUGUCGGUGGG
991 picture button
fru-miR-181a miR-181 Takifugu rubripes
AACAUUCAACGCUGUCGGUGAGU
982 picture button
fru-miR-182 miR-182 Takifugu rubripes
UGGUUCUAGACUUGCCAACUA
718 picture button
fru-miR-183 miR-183 Takifugu rubripes
UAUGGCACUGGUAGAAUUCACUG
743 picture button
fru-miR-184 miR-184 Takifugu rubripes
UGGACGGAGAACUGAUAAGGG
704 picture button
fru-miR-187 miR-187 Takifugu rubripes
UCGUGUCUUGUGUUGCAGCC
732 picture button
fru-miR-189 miR-189 Takifugu rubripes
GUGCCUACUGAACUGGUAUCAGU
714 picture button
fru-miR-190 miR-190 Takifugu rubripes
UGAUAUGUUUGAUAUAUUAGGU
636 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
730 picture button
fru-miR-192 miR-192 Takifugu rubripes
AUGACCUAUGAAUUGACAGCC
741 picture button
fru-miR-193 miR-193 Takifugu rubripes
AACUGGCCUACAAAGUCCCAGU
798 picture button
fru-miR-194 miR-194 Takifugu rubripes
UGUAACAGCAACUCCAUGUGG
720 picture button
fru-miR-196a miR-196 Takifugu rubripes
UAGGUAGUUUCAUGUUGUUGGG
718 picture button
fru-miR-196b miR-196 Takifugu rubripes
UAGGUAGUUUCAAGUUGUUGGG
706 picture button

Page 1 of 2
1 2 next >>

spacer
spacer