spacer

MicroRNA Listing for Drosophila pseudoobscura


88 microRNAs (68 native)

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dps-bantam bantam Drosophila pseudoobscura
UGAGAUCAUUUUGAAAGCUGAUU
229 picture button
dps-let-7 let-7 Drosophila pseudoobscura
UGAGGUAGUAGGUUGUAUAGU
269 picture button
dps-miR-iab-4-5p miR-iab Drosophila pseudoobscura
ACGUAUACUGAAUGUAUCCUGA
210 picture button
dps-miR-iab-4-3p miR-iab Drosophila pseudoobscura
CGGUAUACCUUCAGUAUACGUAAC
195 picture button
dps-miR-1 miR-1 Drosophila pseudoobscura
UGGAAUGUAAAGAAGUAUGGAG
304 picture button
dps-miR-2a miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAUGAGC
320 picture button
dps-miR-2c miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAUGGGC
320 picture button
dps-miR-2b miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAGGAGC
314 picture button
dps-miR-3 miR-3 Drosophila pseudoobscura
UCACUGGGCAAAGUGUGUCUCA
251 picture button
dps-miR-4 miR-4 Drosophila pseudoobscura
AUAAAGCUAGACAACCAUUGA
260 picture button
dps-miR-5 miR-5 Drosophila pseudoobscura
AAAGGAACGAUCGUUGUGAUAUG
238 picture button
dps-miR-6 miR-6 Drosophila pseudoobscura
UAUCACAGUGGCUGUUCUUUUU
301 picture button
dps-miR-7 miR-7 Drosophila pseudoobscura
UGGAAGACUAGUGAUUUUGUUGU
275 picture button
dps-miR-8 miR-8 Drosophila pseudoobscura
UAAUACUGUCAGGUAAAGAUGUC
267 picture button
dps-miR-9b miR-9 Drosophila pseudoobscura
UCUUUGGUGAUUUUAGCUGUAUG
294 picture button
dps-miR-9a miR-9 Drosophila pseudoobscura
UCUUUGGUUAUCUAGCUGUAUGA
281 picture button
dps-miR-9c miR-9 Drosophila pseudoobscura
UCUUUGGUAUUCUAGCUGUAGA
283 picture button
dps-miR-10 miR-10 Drosophila pseudoobscura
ACCCUGUAGAUCCGAAUUUGU
265 picture button
dps-miR-11 miR-11 Drosophila pseudoobscura
CAUCACAGUCUGAGUUCUUGC
321 picture button
dps-miR-12 miR-12 Drosophila pseudoobscura
UGAGUAUUACAUCAGGUACUGGU
192 picture button
dps-miR-13b miR-13 Drosophila pseudoobscura
UAUCACAGCCAUUUUGACGAGU
325 picture button
dps-miR-13a miR-13 Drosophila pseudoobscura
UAUCACAGCCAUUUUGAUGAGU
342 picture button
dps-miR-14 miR-14 Drosophila pseudoobscura
UCAGUCUUUUUCUCUCUCCUA
227 picture button
dps-miR-31a miR-31 Drosophila pseudoobscura
UGGCAAGAUGUCGGCAUAGCUGA
238 picture button
dps-miR-31b miR-31 Drosophila pseudoobscura
UGGCAAGAUGUCGGAAUAGCUGA
251 picture button
dps-miR-33 miR-33 Drosophila pseudoobscura
AGGUGCAUUGUAGUCGCAUUG
252 picture button
dps-miR-34 miR-34 Drosophila pseudoobscura
UGGCAGUGUGGUUAGCUGGUUG
248 picture button
dps-miR-79 miR-79 Drosophila pseudoobscura
UAAAGCUAGAUUACCAAAGCAU
246 picture button
dps-miR-87 miR-87 Drosophila pseudoobscura
UUGAGCAAAAUUUCAGGUGUG
259 picture button
dps-miR-92b miR-92 Drosophila pseudoobscura
AAUUGCACUAGUCCCGGCCUGC
307 picture button
dps-miR-92a miR-92 Drosophila pseudoobscura
CAUUGCACUUGUCCCGGCCUAU
300 picture button
dps-miR-100 miR-100 Drosophila pseudoobscura
AACCCGUAAUUCCGAACUUGUG
243 picture button
dps-miR-124 miR-124 Drosophila pseudoobscura
UAAGGCACGCGGUGAAUGCCAAG
245 picture button
dps-miR-125 miR-125 Drosophila pseudoobscura
UCCCUGAGACCCUAACUUGUGA
282 picture button
dps-miR-133 miR-133 Drosophila pseudoobscura
UUGGUCCCCUUCAACCAGCUGU
252 picture button
dps-miR-184 miR-184 Drosophila pseudoobscura
UGGACGGAGAACUGAUAAGGGC
233 picture button
dps-miR-210 miR-210 Drosophila pseudoobscura
UUGUGCGUGUGACAGCGGCUA
255 picture button
dps-miR-219 miR-219 Drosophila pseudoobscura
UGAUUGUCCAAACGCAAUUCUUG
281 picture button
dps-miR-263a miR-263 Drosophila pseudoobscura
GUUAAUGGCACUGGAAGAAUUCAC
292 picture button
dps-miR-263b miR-263 Drosophila pseudoobscura
CUUGGCACUGGGAGAAUUCAC
241 picture button
dps-miR-274 miR-274 Drosophila pseudoobscura
UUUUGUGACCGACACUAACGGGUAAU
252 picture button
dps-miR-275 miR-275 Drosophila pseudoobscura
UCAGGUACCUGAAGUAGCGCGCG
202 picture button
dps-miR-276b miR-276 Drosophila pseudoobscura
UAGGAACUUAAUACCGUGCUCU
234 picture button
dps-miR-276a miR-276 Drosophila pseudoobscura
UAGGAACUUCAUACCGUGCUCU
235 picture button
dps-miR-277 miR-277 Drosophila pseudoobscura
UAAAUGCACUAUCUGGUACGACA
318 picture button
dps-miR-278 miR-278 Drosophila pseudoobscura
UCGGUGGGACUUUCGUCCGUUU
184 picture button
dps-miR-279 miR-279 Drosophila pseudoobscura
UGACUAGAUCCACACUCAUUAA
238 picture button
dps-miR-280 miR-280 Drosophila pseudoobscura
UGUAUUUACGUUGCAUAUGAAAUGAUA
258 picture button
dps-miR-281 miR-281 Drosophila pseudoobscura
UGUCAUGGAAUUGCUCUCUUUGU
231 picture button
dps-miR-282 miR-282 Drosophila pseudoobscura
AAUCUAGCCUCUACUAGGCUUUGUCUGU
214 picture button
dps-miR-283 miR-283 Drosophila pseudoobscura
UAAAUAUCAGCUGGUAAUUCU
266 picture button
dps-miR-284 miR-284 Drosophila pseudoobscura
UGAAGUCAGCAACUUGAUUCCAGCAAUUG
234 picture button
dps-miR-285 miR-285 Drosophila pseudoobscura
UAGCACCAUUCGAAAUCAGUGC
177 picture button
dps-miR-286 miR-286 Drosophila pseudoobscura
UGACUAGACCGAACACUCGUGCU
265 picture button
dps-miR-287 miR-287 Drosophila pseudoobscura
UGUGUUGAAAAUCGUUUGCAC
225 picture button
dps-miR-288 miR-288 Drosophila pseudoobscura
UUUCAUGUCGAUUUCAUUUCAUG
202 picture button
dps-miR-289 miR-289 Drosophila pseudoobscura
UAAAUAUUUAAGUGGAGCCUGCGACU
222 picture button
dme-miR-303 miR-303 Drosophila melanogaster
UUUAGGUUUCACAGGAAACUGGU
206 picture button
dps-miR-304 miR-304 Drosophila pseudoobscura
UAAUCUCAAUUUGUAAAUGUGAG
233 picture button
dps-miR-305 miR-305 Drosophila pseudoobscura
AUUGUACUUCAUCAGGUGCUCUG
249 picture button
dps-miR-306 miR-306 Drosophila pseudoobscura
UCAGGUACUUAGUGACUCUCAA
201 picture button
dps-miR-307 miR-307 Drosophila pseudoobscura
UCACAACCUCCUUGAGUGAG
205 picture button
dps-miR-308 miR-308 Drosophila pseudoobscura
AAUCACAGGAUUAUACUGUGAG
292 picture button
dps-miR-309 miR-309 Drosophila pseudoobscura
GCACUGGGUGAAGUUUGUCUUA
250 picture button
dme-miR-310 miR-310 Drosophila melanogaster
UAUUGCACACUUCCCGGCCUUU
279 picture button
dme-miR-311 miR-311 Drosophila melanogaster
UAUUGCACAUUCACCGGCCUGA
273 picture button
dme-miR-312 miR-312 Drosophila melanogaster
UAUUGCACUUGAGACGGCCUGA
294 picture button
dme-miR-313 miR-313 Drosophila melanogaster
UAUUGCACUUUUCACAGCCCGA
279 picture button
dps-miR-314 miR-314 Drosophila pseudoobscura
UAUUCGAGCCAAUAAGUUCGG
233 picture button
dps-miR-315 miR-315 Drosophila pseudoobscura
UUUUGAUUGUUGCUCAGAAAGC
190 picture button
dps-miR-316 miR-316 Drosophila pseudoobscura
UGUCUUUUUCCGCUUACUGGCG
173 picture button
dps-miR-317 miR-317 Drosophila pseudoobscura
UGAACACAGCUGGUGGUAUCCAAU
221 picture button
dps-miR-318 miR-318 Drosophila pseudoobscura
UCACUGGGCUUUGUUUAUCUCA
239 picture button
dme-miR-1003 miR-1003 Drosophila melanogaster
UCUCACAUUUACAUAUUCACAG
214 picture button
dme-miR-1004 miR-1004 Drosophila melanogaster
UCUCACAUCACUUCCCUCACAG
199 picture button
dme-miR-1005 miR-1005 Drosophila melanogaster
UCUGGAAUCUUUAAUUCGCAG
246 picture button
dme-miR-1006 miR-1006 Drosophila melanogaster
UAAAUUCGAUUUCUUAUUCAUAG
246 picture button
dme-miR-1007 miR-1007 Drosophila melanogaster
UAAGCUCAAUUAACUGUUUGCA
228 picture button
dme-miR-1008 miR-1008 Drosophila melanogaster
UCACAGCUUUUUGUGUUUACA
228 picture button
dme-miR-1009 miR-1009 Drosophila melanogaster
UCUCAAAAAUUGUUACAUUUCAG
188 picture button
dme-miR-1010 miR-1010 Drosophila melanogaster
UUUCACCUAUCGUUCCAUUUGCAG
183 picture button
dme-miR-1011 miR-1011 Drosophila melanogaster
UUAUUGGUUCAAAUCGCUCGCAG
257 picture button
dme-miR-1012 miR-1012 Drosophila melanogaster
UUAGUCAAAGAUUUUCCCCAUAG
234 picture button
dme-miR-1013 miR-1013 Drosophila melanogaster
AUAAAAGUAUGCCGAACUCG
247 picture button
dme-miR-1014 miR-1014 Drosophila melanogaster
AAAAUUCAUUUUCAUUUGCAG
245 picture button
dme-miR-1015 miR-1015 Drosophila melanogaster
UCCUGGGACAUCUCUCUUGCAG
223 picture button
dme-miR-1016 miR-1016 Drosophila melanogaster
UUCACCUCUCUCCAUACUUAG
171 picture button
dme-miR-1017 miR-1017 Drosophila melanogaster
GAAAGCUCUACCCAAACUCAUCC
204 picture button
spacer
spacer