spacer

MicroRNA Listing for Caenorhabditis elegans


136 microRNAs (136 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
cel-lin-4 lin-4 Caenorhabditis elegans
UCCCUGAGACCUCAAGUGUGA
526 picture button
cel-lsy-6 lsy-6 Caenorhabditis elegans
UUUUGUAUGAGACGCAUUUCG
360 picture button
cel-let-7 let-7 Caenorhabditis elegans
UGAGGUAGUAGGUUGUAUAGUU
518 picture button
cel-miR-1 miR-1 Caenorhabditis elegans
UGGAAUGUAAAGAAGUAUGUA
528 picture button
cel-miR-2 miR-2 Caenorhabditis elegans
UAUCACAGCCAGCUUUGAUGUGC
582 picture button
cel-miR-34 miR-34 Caenorhabditis elegans
AGGCAGUGUGGUUAGCUGGUUG
564 picture button
cel-miR-35 miR-35 Caenorhabditis elegans
UCACCGGGUGGAAACUAGCAGU
487 picture button
cel-miR-36 miR-36 Caenorhabditis elegans
UCACCGGGUGAAAAUUCGCAUG
484 picture button
cel-miR-37 miR-37 Caenorhabditis elegans
UCACCGGGUGAACACUUGCAGU
514 picture button
cel-miR-38 miR-38 Caenorhabditis elegans
UCACCGGGAGAAAAACUGGAGU
502 picture button
cel-miR-39 miR-39 Caenorhabditis elegans
UCACCGGGUGUAAAUCAGCUUG
490 picture button
cel-miR-40 miR-40 Caenorhabditis elegans
UCACCGGGUGUACAUCAGCUAA
478 picture button
cel-miR-41 miR-41 Caenorhabditis elegans
UCACCGGGUGAAAAAUCACCUA
490 picture button
cel-miR-42 miR-42 Caenorhabditis elegans
UCACCGGGUUAACAUCUACAGA
502 picture button
cel-miR-43 miR-43 Caenorhabditis elegans
UAUCACAGUUUACUUGCUGUCGC
582 picture button
cel-miR-44 miR-44 Caenorhabditis elegans
UGACUAGAGACACAUUCAGCU
656 picture button
cel-miR-46 miR-46 Caenorhabditis elegans
UGUCAUGGAGUCGCUCUCUUCA
432 picture button
cel-miR-47 miR-47 Caenorhabditis elegans
UGUCAUGGAGGCGCUCUCUUCA
438 picture button
cel-miR-48 miR-48 Caenorhabditis elegans
UGAGGUAGGCUCAGUAGAUGCGA
425 picture button
cel-miR-49 miR-49 Caenorhabditis elegans
AAGCACCACGAGAAGCUGCAGA
562 picture button
cel-miR-50 miR-50 Caenorhabditis elegans
UGAUAUGUCUGGUAUUCUUGGG
364 picture button
cel-miR-51 miR-51 Caenorhabditis elegans
UACCCGUAGCUCCUAUCCAUGUU
652 picture button
cel-miR-52 miR-52 Caenorhabditis elegans
CACCCGUACAUAUGUUUCCGUGCU
678 picture button
cel-miR-53 miR-53 Caenorhabditis elegans
CACCCGUACAUUUGUUUCCGUGCU
655 picture button
cel-miR-54 miR-54 Caenorhabditis elegans
UACCCGUAAUCUUCAUAAUCCGAG
683 picture button
cel-miR-55 miR-55 Caenorhabditis elegans
UACCCGUAUAAGUUUCUGCUGAG
677 picture button
cel-miR-56* miR-56* Caenorhabditis elegans
UGGCGGAUCCAUUUUGGGUUGUA
428 picture button
cel-miR-56 miR-56 Caenorhabditis elegans
UACCCGUAAUGUUUCCGCUGAG
694 picture button
cel-miR-57 miR-57 Caenorhabditis elegans
UACCCUGUAGAUCGAGCUGUGUGU
492 picture button
cel-miR-58 miR-58 Caenorhabditis elegans
UGAGAUCGUUCAGUACGGCAAU
524 picture button
cel-miR-59 miR-59 Caenorhabditis elegans
UCGAAUCGUUUAUCAGGAUGAUG
524 picture button
cel-miR-60 miR-60 Caenorhabditis elegans
UAUUAUGCACAUUUUCUAGUUCA
579 picture button
cel-miR-61 miR-61 Caenorhabditis elegans
UGACUAGAACCGUUACUCAUC
614 picture button
cel-miR-62 miR-62 Caenorhabditis elegans
UGAUAUGUAAUCUAGCUUACAG
421 picture button
cel-miR-63 miR-63 Caenorhabditis elegans
UAUGACACUGAAGCGAGUUGGAAA
546 picture button
cel-miR-64 miR-64 Caenorhabditis elegans
UAUGACACUGAAGCGUUACCGAA
483 picture button
cel-miR-65 miR-65 Caenorhabditis elegans
UAUGACACUGAAGCGUAACCGAA
495 picture button
cel-miR-66 miR-66 Caenorhabditis elegans
CAUGACACUGAUUAGGGAUGUGA
527 picture button
cel-miR-67 miR-67 Caenorhabditis elegans
UCACAACCUCCUAGAAAGAGUAGA
556 picture button
cel-miR-70 miR-70 Caenorhabditis elegans
UAAUACGUCGUUGGUGUUUCCAU
495 picture button
cel-miR-71 miR-71 Caenorhabditis elegans
UGAAAGACAUGGGUAGUGA
466 picture button
cel-miR-72 miR-72 Caenorhabditis elegans
AGGCAAGAUGUUGGCAUAGCUGA
460 picture button
cel-miR-73 miR-73 Caenorhabditis elegans
UGGCAAGAUGUAGGCAGUUCAGU
471 picture button
cel-miR-74 miR-74 Caenorhabditis elegans
UGGCAAGAAAUGGCAGUCUACA
461 picture button
cel-miR-75 miR-75 Caenorhabditis elegans
UUAAAGCUACCAACCGGCUUCA
473 picture button
cel-miR-76 miR-76 Caenorhabditis elegans
UUCGUUGUUGAUGAAGCCUUGA
438 picture button
cel-miR-77 miR-77 Caenorhabditis elegans
UUCAUCAGGCCAUAGCUGUCCA
537 picture button
cel-miR-78 miR-78 Caenorhabditis elegans
UGGAGGCCUGGUUGUUUGUGC
497 picture button
cel-miR-79 miR-79 Caenorhabditis elegans
AUAAAGCUAGGUUACCAAAGCU
506 picture button
cel-miR-80 miR-80 Caenorhabditis elegans
UGAGAUCAUUAGUUGAAAGCCGA
584 picture button
cel-miR-81 miR-81 Caenorhabditis elegans
UGAGAUCAUCGUGAAAGCUAGU
597 picture button
cel-miR-82 miR-82 Caenorhabditis elegans
UGAGAUCAUCGUGAAAGCCAGU
580 picture button
cel-miR-83 miR-83 Caenorhabditis elegans
UAGCACCAUAUAAAUUCAGUAA
526 picture button
cel-miR-84 miR-84 Caenorhabditis elegans
UGAGGUAGUAUGUAAUAUUGUA
448 picture button
cel-miR-85 miR-85 Caenorhabditis elegans
UACAAAGUAUUUGAAAAGUCGUGC
493 picture button
cel-miR-86 miR-86 Caenorhabditis elegans
UAAGUGAAUGCUUUGCCACAGUC
381 picture button
cel-miR-87 miR-87 Caenorhabditis elegans
GUGAGCAAAGUUUCAGGUGUGC
593 picture button
cel-miR-90 miR-90 Caenorhabditis elegans
UGAUAUGUUGUUUGAAUGCCCCU
417 picture button
cel-miR-124 miR-124 Caenorhabditis elegans
UAAGGCACGCGGUGAAUGCCA
717 picture button
cel-miR-227 miR-227 Caenorhabditis elegans
AGCUUUCGACAUGAUUCUGAAC
442 picture button
cel-miR-228 miR-228 Caenorhabditis elegans
AAUGGCACUGCAUGAAUUCACGG
642 picture button
cel-miR-229 miR-229 Caenorhabditis elegans
AAUGACACUGGUUAUCUUUUCCAUCG
529 picture button
cel-miR-230 miR-230 Caenorhabditis elegans
GUAUUAGUUGUGCGACCAGGAGA
488 picture button
cel-miR-231 miR-231 Caenorhabditis elegans
UAAGCUCGUGAUCAACAGGCAGAA
548 picture button
cel-miR-232 miR-232 Caenorhabditis elegans
UAAAUGCAUCUUAACUGCGGUGA
524 picture button
cel-miR-233 miR-233 Caenorhabditis elegans
UUGAGCAAUGCGCAUGUGCGG
612 picture button
cel-miR-234 miR-234 Caenorhabditis elegans
UUAUUGCUCGAGAAUACCCUU
486 picture button
cel-miR-235 miR-235 Caenorhabditis elegans
UAUUGCACUCUCCCCGGCCUGA
578 picture button
cel-miR-236 miR-236 Caenorhabditis elegans
UAAUACUGUCAGGUAAUGACGCU
612 picture button
cel-miR-237 miR-237 Caenorhabditis elegans
UCCCUGAGAAUUCUCGAACAGCU
534 picture button
cel-miR-238 miR-238 Caenorhabditis elegans
UUUGUACUCCGAUGCCAUUCAGA
513 picture button
cel-miR-239a miR-239 Caenorhabditis elegans
UUUGUACUACACAUAGGUACUGG
510 picture button
cel-miR-239b miR-239 Caenorhabditis elegans
UUUGUACUACACAAAAGUACUG
546 picture button
cel-miR-240 miR-240 Caenorhabditis elegans
UACUGGCCCCCAAAUCUUCGCU
444 picture button
cel-miR-241 miR-241 Caenorhabditis elegans
UGAGGUAGGUGCGAGAAAUGA
412 picture button
cel-miR-242 miR-242 Caenorhabditis elegans
UUGCGUAGGCCUUUGCUUCGA
458 picture button
cel-miR-243 miR-243 Caenorhabditis elegans
CGGUACGAUCGCGGCGGGAUAUC
503 picture button
cel-miR-244 miR-244 Caenorhabditis elegans
UCUUUGGUUGUACAAAGUGGUAUG
448 picture button
cel-miR-245 miR-245 Caenorhabditis elegans
AUUGGUCCCCUCCAAGUAGCUC
490 picture button
cel-miR-246 miR-246 Caenorhabditis elegans
UUACAUGUUUCGGGUAGGAGC
536 picture button
cel-miR-247 miR-247 Caenorhabditis elegans
UGACUAGAGCCUAUUCUCUUCU
595 picture button
cel-miR-248 miR-248 Caenorhabditis elegans
AUACACGUGCACGGAUAACGCUCA
665 picture button
cel-miR-249 miR-249 Caenorhabditis elegans
UCACAGGACUUUUGAGCGUUGCC
550 picture button
cel-miR-250 miR-250 Caenorhabditis elegans
AAUCACAGUCAACUGUUGGCA
630 picture button
cel-miR-251 miR-251 Caenorhabditis elegans
UUAAGUAGUGGUGCCGCUCUUAUU
423 picture button
cel-miR-252 miR-252 Caenorhabditis elegans
AUAAGUAGUAGUGCCGCAGGUAA
452 picture button
cel-miR-253* miR-253* Caenorhabditis elegans
CACACCUCACUAACACUGACC
426 picture button
cel-miR-253 miR-253 Caenorhabditis elegans
UUAGUAGGCGUUGUGGGAAGG
523 picture button
cel-miR-254 miR-254 Caenorhabditis elegans
UGCAAAUCUUUCGCGACUGUAGG
499 picture button
cel-miR-255 miR-255 Caenorhabditis elegans
AAACUGAAGAGAUUUUUUACAG
522 picture button
cel-miR-256 miR-256 Caenorhabditis elegans
UGGAAUGCAUAGAAGACUGUA
550 picture button
cel-miR-257 miR-257 Caenorhabditis elegans
GAGUAUCAGGAGUACCCAGUGA
622 picture button
cel-miR-258 miR-258 Caenorhabditis elegans
GGUUUUGAGAGGAAUCCUUUU
344 picture button
cel-miR-259 miR-259 Caenorhabditis elegans
AAAUCUCAUCCUAAUCUGGUAGCA
590 picture button
cel-miR-260 miR-260 Caenorhabditis elegans
GUGAUGUCGAACUCUUGUAG
566 picture button
cel-miR-261 miR-261 Caenorhabditis elegans
UAGCUUUUUAGUUUUCACG
418 picture button
cel-miR-262 miR-262 Caenorhabditis elegans
GUUUCUCGAUGUUUUCUGAU
441 picture button
cel-miR-264 miR-264 Caenorhabditis elegans
GGCGGGUGGUUGUUGUUAUG
475 picture button
cel-miR-265 miR-265 Caenorhabditis elegans
UGAGGGAGGAAGGGUGGUAU
273 picture button
cel-miR-266 miR-266 Caenorhabditis elegans
AGGCAAGACUUUGGCAAAGC
490 picture button

Page 1 of 2
1 2 next >>

spacer
spacer