spacer

MicroRNA Listing for Caenorhabditis briggsae


135 microRNAs (92 native)


Page 2 of 2
<< prev 1 2

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
cel-miR-269 miR-269 Caenorhabditis elegans
GGCAAGACUCUGGCAAAACU
170 picture button
cel-miR-270 miR-270 Caenorhabditis elegans
GGCAUGAUGUAGCAGUGGAG
150 picture button
cel-miR-271 miR-271 Caenorhabditis elegans
UCGCCGGGUGGGAAAGCAUU
185 picture button
cel-miR-272 miR-272 Caenorhabditis elegans
UGUAGGCAUGGGUGUUUG
158 picture button
cel-miR-273 miR-273 Caenorhabditis elegans
UGCCCGUACUGUGUCGGCUG
209 picture button
cbr-miR-353 miR-353 Caenorhabditis briggsae
CAAGUAUCAUGUGUUGGUAUC
154 picture button
cbr-miR-354 miR-354 Caenorhabditis briggsae
ACCUUGUUUGUUGCUGCUCCU
168 picture button
cbr-miR-355 miR-355 Caenorhabditis briggsae
UUUGUUUUAGCCUGAGCUAUG
84 picture button
cbr-miR-356 miR-356 Caenorhabditis briggsae
AUGAGCAACGCGAACAAAUCC
146 picture button
cbr-miR-357 miR-357 Caenorhabditis briggsae
AAAAUGCCAGUCAUUGACGGA
203 picture button
cbr-miR-358 miR-358 Caenorhabditis briggsae
CAAUUGGUAUCCUUAGUCGUGG
81 picture button
cbr-miR-359 miR-359 Caenorhabditis briggsae
UCACUGGUUAUCCUCUGUCGAA
136 picture button
cbr-miR-360 miR-360 Caenorhabditis briggsae
UGACCGUAAUCCCGUUCACAA
139 picture button
cbr-miR-392 miR-392 Caenorhabditis briggsae
UAUCAUCGAUCAUGUGAGCUGU
125 picture button
cbr-miR-784 miR-784 Caenorhabditis briggsae
UGGCACAAUACCUGUAUGUAGA
174 picture button
cbr-miR-785 miR-785 Caenorhabditis briggsae
UAAGUGAAUACUCUGUGUUGA
105 picture button
cbr-miR-786 miR-786 Caenorhabditis briggsae
UAAUGCCCUGUACGAGAUUUGGU
197 picture button
cbr-miR-787 miR-787 Caenorhabditis briggsae
UAAGCUCGUCUUAGUUUUCCUCU
142 picture button
cbr-miR-788 miR-788 Caenorhabditis briggsae
UCCGCUUCUCAAUGCUCCAUUUGCAA
175 picture button
cbr-miR-789b miR-789 Caenorhabditis briggsae
GCCCUGCCUGGGUCACCAUGUGA
185 picture button
cbr-miR-789a miR-789 Caenorhabditis briggsae
UCCCUGCCUGGGUCAAAUGUUUU
156 picture button
cbr-miR-790 miR-790 Caenorhabditis briggsae
CUUGGCACUCGCGAACACCGCG
175 picture button
cbr-miR-791 miR-791 Caenorhabditis briggsae
AUUGGCACUCCGCUGAUUUGGUG
171 picture button
cbr-miR-792 miR-792 Caenorhabditis briggsae
UUGAAAUUUUUUCUAUUUUCGGU
100 picture button
cel-miR-793 miR-793 Caenorhabditis elegans
UGAGGUAUCUUAGUUAGACAGA
126 picture button
cel-miR-794 miR-794 Caenorhabditis elegans
UGAGGUAAUCAUCGUUGUCACU
122 picture button
cel-miR-795 miR-795 Caenorhabditis elegans
UGAGGUAGAUUGAUCAGCGAGCUU
117 picture button
cel-miR-796 miR-796 Caenorhabditis elegans
UGGAAUGUAGUUGAGGUUAGUAA
140 picture button
cel-miR-797 miR-797 Caenorhabditis elegans
UAUCACAGCAAUCACAAUGAGAAGA
191 picture button
cel-miR-798 miR-798 Caenorhabditis elegans
UAAGCCUUACAUAUUGACUGA
170 picture button
cel-miR-799 miR-799 Caenorhabditis elegans
UGAACCCUGAUAAAGCUAGUGG
202 picture button
cel-miR-800 miR-800 Caenorhabditis elegans
CAAACUCGGAAAUUGUCUGCCG
191 picture button
cel-miR-1018 miR-1018 Caenorhabditis elegans
AGAGAGAUCAUUGGACUUACAG
125 picture button
cel-miR-1019 miR-1019 Caenorhabditis elegans
CUGUAAUUCCACAUUGCUUUCCAG
146 picture button
cel-miR-1020 miR-1020 Caenorhabditis elegans
AUUAUUCUGUGACACUUUCAG
112 picture button

Page 2 of 2
<< prev 1 2

spacer
spacer