spacer

MicroRNA Listing for Caenorhabditis briggsae


135 microRNAs (92 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
cbr-lin-4 lin-4 Caenorhabditis briggsae
UCCCUGAGACCUCAAGUGUGA
183 picture button
cbr-lsy-6 lsy-6 Caenorhabditis briggsae
UUUUGUAUGAGACGCAUUCCG
125 picture button
cbr-let-7 let-7 Caenorhabditis briggsae
UGAGGUAGUAGGUUGUAUAGUU
142 picture button
cbr-miR-1 miR-1 Caenorhabditis briggsae
UGGAAUGUAAAGAAGUAUGUA
147 picture button
cel-miR-2 miR-2 Caenorhabditis elegans
UAUCACAGCCAGCUUUGAUGUGC
173 picture button
cbr-miR-34 miR-34 Caenorhabditis briggsae
AGGCAGUGUGGUUAGCUGGUUG
178 picture button
cbr-miR-35 miR-35 Caenorhabditis briggsae
UCACCGGGUGAAAACUUGCAAG
213 picture button
cbr-miR-36 miR-36 Caenorhabditis briggsae
UCACCGGGUGAAAAUUCGCAAU
209 picture button
cel-miR-37 miR-37 Caenorhabditis elegans
UCACCGGGUGAACACUUGCAGU
234 picture button
cbr-miR-38 miR-38 Caenorhabditis briggsae
UCACCGGGAGACAACCUGGUAU
198 picture button
cbr-miR-39 miR-39 Caenorhabditis briggsae
UCACCGGGUGAAAAACGGUUAG
201 picture button
cbr-miR-40 miR-40 Caenorhabditis briggsae
UCACCGGGUGUCAAUCAGCUAG
196 picture button
cbr-miR-41 miR-41 Caenorhabditis briggsae
UCACCGGGUGAAAAACUCCCA
205 picture button
cbr-miR-42 miR-42 Caenorhabditis briggsae
CACCGGGUUAACAUCUACAG
160 picture button
cbr-miR-43 miR-43 Caenorhabditis briggsae
UAUCACAGUUUACUUGCUGUCGC
205 picture button
cbr-miR-44 miR-44 Caenorhabditis briggsae
UGACUAGAGACACAUUCAGCU
187 picture button
cbr-miR-46 miR-46 Caenorhabditis briggsae
UGUCAUGGAGUCGCUCUCUUCA
134 picture button
cbr-miR-47 miR-47 Caenorhabditis briggsae
UGUCAUGGAGGCGCUCUCUUCA
154 picture button
cbr-miR-48 miR-48 Caenorhabditis briggsae
UGAGGUAGGCUCAGUAGAUGCGA
128 picture button
cbr-miR-49 miR-49 Caenorhabditis briggsae
AAGCACCACGAGAAGCUGCAGA
219 picture button
cbr-miR-50 miR-50 Caenorhabditis briggsae
UGAUAUGUCUGAUAUUCUUGGGUU
134 picture button
cbr-miR-51 miR-51 Caenorhabditis briggsae
UACCCGUAGCUCCUUGCCAUGUU
257 picture button
cbr-miR-52 miR-52 Caenorhabditis briggsae
CACCCGUACAUAUGUUUCCGUGCU
235 picture button
cel-miR-53 miR-53 Caenorhabditis elegans
CACCCGUACAUUUGUUUCCGUGCU
241 picture button
cel-miR-54 miR-54 Caenorhabditis elegans
UACCCGUAAUCUUCAUAAUCCGAG
238 picture button
cbr-miR-55 miR-55 Caenorhabditis briggsae
UACCCGUAUAUUUUUCUGCCGAG
237 picture button
cel-miR-56 miR-56 Caenorhabditis elegans
UACCCGUAAUGUUUCCGCUGAG
251 picture button
cbr-miR-57 miR-57 Caenorhabditis briggsae
UACCCUGUAGAUCGAGCUGUGUGU
189 picture button
cbr-miR-58 miR-58 Caenorhabditis briggsae
UGAGAUCGUUCAGUACGGCAAU
151 picture button
cel-miR-59 miR-59 Caenorhabditis elegans
UCGAAUCGUUUAUCAGGAUGAUG
154 picture button
cbr-miR-60 miR-60 Caenorhabditis briggsae
UAUUAUGCACAUUUUCUAGUCCA
201 picture button
cbr-miR-61 miR-61 Caenorhabditis briggsae
UGACUAGAACCUUGACUCUGCUC
177 picture button
cbr-miR-62 miR-62 Caenorhabditis briggsae
UGAUAUGUAAUCUAGCUUACAG
125 picture button
cel-miR-63 miR-63 Caenorhabditis elegans
UAUGACACUGAAGCGAGUUGGAAA
189 picture button
cbr-miR-64 miR-64 Caenorhabditis briggsae
CAUGACACUGAAGCGUGUACGGA
197 picture button
cel-miR-65 miR-65 Caenorhabditis elegans
UAUGACACUGAAGCGUAACCGAA
186 picture button
cel-miR-66 miR-66 Caenorhabditis elegans
CAUGACACUGAUUAGGGAUGUGA
189 picture button
cbr-miR-67 miR-67 Caenorhabditis briggsae
UCACAACCUCCUAGAAAGAGUAGA
221 picture button
cbr-miR-70 miR-70 Caenorhabditis briggsae
UAAUACGUGAUUGGUGUUCCCAG
156 picture button
cbr-miR-71 miR-71 Caenorhabditis briggsae
UGAAAGACAUGGGUAGUGA
127 picture button
cbr-miR-72 miR-72 Caenorhabditis briggsae
AGGCAGAUGUUGGCAUAGC
123 picture button
cbr-miR-73 miR-73 Caenorhabditis briggsae
UGGCAAGAUGUUGGCAGUUCAGU
138 picture button
cbr-miR-74 miR-74 Caenorhabditis briggsae
UGGCAAGAAAUGGCAGUCUAGA
127 picture button
cbr-miR-75 miR-75 Caenorhabditis briggsae
UUAAAGCUACCAACCGCCUUCA
140 picture button
cel-miR-76 miR-76 Caenorhabditis elegans
UUCGUUGUUGAUGAAGCCUUGA
137 picture button
cbr-miR-77 miR-77 Caenorhabditis briggsae
UUCAUCAGGCCAUAGCUGUCCA
116 picture button
cel-miR-78 miR-78 Caenorhabditis elegans
UGGAGGCCUGGUUGUUUGUGC
169 picture button
cbr-miR-79 miR-79 Caenorhabditis briggsae
AUAAAGCUAGGUUACCAAAGCU
150 picture button
cbr-miR-80 miR-80 Caenorhabditis briggsae
UGAGAUCAUUAGUUGAAAGCCGA
155 picture button
cbr-miR-81 miR-81 Caenorhabditis briggsae
UGAGAUCAUCGUGAAAGCUAGU
161 picture button
cbr-miR-82 miR-82 Caenorhabditis briggsae
UGAGAUCAUCGUGAAAGCCAGU
165 picture button
cbr-miR-83 miR-83 Caenorhabditis briggsae
UAGCACCAUAUAAAUUCAGUGU
207 picture button
cbr-miR-84 miR-84 Caenorhabditis briggsae
UGAGGUAGUUUGCAAUGCUGUC
137 picture button
cbr-miR-85 miR-85 Caenorhabditis briggsae
UACAAAGUAUUUGAAAAGGCGUGC
141 picture button
cbr-miR-86 miR-86 Caenorhabditis briggsae
UAAGUGAAUGCUUUGCCACAGUC
101 picture button
cbr-miR-87 miR-87 Caenorhabditis briggsae
GUGAGCAAAGUUUCAGGUGU
171 picture button
cbr-miR-90 miR-90 Caenorhabditis briggsae
UGAUAUGUUGUUUGAAUGCCCC
117 picture button
cbr-miR-124 miR-124 Caenorhabditis briggsae
UAAGGCACGCGGUGAAUGCCA
251 picture button
cel-miR-227 miR-227 Caenorhabditis elegans
AGCUUUCGACAUGAUUCUGAAC
132 picture button
cbr-miR-228 miR-228 Caenorhabditis briggsae
AAUGGCACUGCAUGAAUUCACGG
190 picture button
cel-miR-229 miR-229 Caenorhabditis elegans
AAUGACACUGGUUAUCUUUUCCAUCG
181 picture button
cbr-miR-230 miR-230 Caenorhabditis briggsae
GUAUUAGUUGUGCGACCAGGAAA
125 picture button
cbr-miR-231 miR-231 Caenorhabditis briggsae
UAAGCUCGUGAACAACAGGCAGGA
168 picture button
cbr-miR-232 miR-232 Caenorhabditis briggsae
UAAAUGCAUCUUAACUGCGGUGA
139 picture button
cbr-miR-233 miR-233 Caenorhabditis briggsae
UUGAGCAAUGCGCAUGUGCGGGA
152 picture button
cbr-miR-234 miR-234 Caenorhabditis briggsae
UUAUUGCUCGAGAAUACCCUU
147 picture button
cbr-miR-235 miR-235 Caenorhabditis briggsae
UAUUGCACUUUCCCUGGCCAGA
198 picture button
cbr-miR-236 miR-236 Caenorhabditis briggsae
UAAUACUGUCAGGUAAUGACGCU
171 picture button
cel-miR-237 miR-237 Caenorhabditis elegans
UCCCUGAGAAUUCUCGAACAGCU
198 picture button
cel-miR-238 miR-238 Caenorhabditis elegans
UUUGUACUCCGAUGCCAUUCAGA
166 picture button
cbr-miR-239a miR-239 Caenorhabditis briggsae
UUUGUACUACAAUUAGGUACUGG
166 picture button
cbr-miR-239b miR-239 Caenorhabditis briggsae
UUGUACUGCACAAAAGUACUG
164 picture button
cbr-miR-240 miR-240 Caenorhabditis briggsae
UACUGGCCUCCAAAUUUUCGCU
167 picture button
cbr-miR-241 miR-241 Caenorhabditis briggsae
UGAGGUAGGUGUGAGAAAUGA
123 picture button
cbr-miR-242 miR-242 Caenorhabditis briggsae
UUGCGUAGGCCUUUGUUUCGA
165 picture button
cel-miR-243 miR-243 Caenorhabditis elegans
CGGUACGAUCGCGGCGGGAUAUC
134 picture button
cbr-miR-244 miR-244 Caenorhabditis briggsae
UCUUUGGUUGUACAAAGUGGUAUG
134 picture button
cbr-miR-245 miR-245 Caenorhabditis briggsae
AUUGGUCCCCUCCAAGUAGCUC
135 picture button
cbr-miR-246 miR-246 Caenorhabditis briggsae
UUACAUGUAUUGGGUAGGAGCU
169 picture button
cel-miR-247 miR-247 Caenorhabditis elegans
UGACUAGAGCCUAUUCUCUUCU
166 picture button
cbr-miR-248 miR-248 Caenorhabditis briggsae
UACACGUGCUCGGAUAACGCUCA
192 picture button
cbr-miR-249 miR-249 Caenorhabditis briggsae
UCACAGGAUUUUUGAGUGUUGC
179 picture button
cbr-miR-250 miR-250 Caenorhabditis briggsae
UCACAGUCAACUGUUGGCACGG
188 picture button
cbr-miR-251 miR-251 Caenorhabditis briggsae
UUAAGUAGUGGUGCCGCUCUUAUU
121 picture button
cbr-miR-252 miR-252 Caenorhabditis briggsae
UAAGUAGUAGUGCCGCAGGUAAC
116 picture button
cbr-miR-253 miR-253 Caenorhabditis briggsae
CACACCUCACUAACACUAACU
201 picture button
cbr-miR-254 miR-254 Caenorhabditis briggsae
UGCAAAUCUUUUGCAACUGUAUA
173 picture button
cbr-miR-255 miR-255 Caenorhabditis briggsae
AAACUGAAGAGAUUUUUUACAG
141 picture button
cel-miR-256 miR-256 Caenorhabditis elegans
UGGAAUGCAUAGAAGACUGUA
133 picture button
cel-miR-257 miR-257 Caenorhabditis elegans
GAGUAUCAGGAGUACCCAGUGA
129 picture button
cel-miR-258 miR-258 Caenorhabditis elegans
GGUUUUGAGAGGAAUCCUUUU
121 picture button
cbr-miR-259 miR-259 Caenorhabditis briggsae
AAAUCUCAUCCUAAUCUGGUU
189 picture button
cel-miR-260 miR-260 Caenorhabditis elegans
GUGAUGUCGAACUCUUGUAG
128 picture button
cel-miR-261 miR-261 Caenorhabditis elegans
UAGCUUUUUAGUUUUCACG
92 picture button
cel-miR-262 miR-262 Caenorhabditis elegans
GUUUCUCGAUGUUUUCUGAU
127 picture button
cel-miR-264 miR-264 Caenorhabditis elegans
GGCGGGUGGUUGUUGUUAUG
150 picture button
cel-miR-265 miR-265 Caenorhabditis elegans
UGAGGGAGGAAGGGUGGUAU
80 picture button
cel-miR-266 miR-266 Caenorhabditis elegans
AGGCAAGACUUUGGCAAAGC
113 picture button
cel-miR-267 miR-267 Caenorhabditis elegans
CCCGUGAAGUGUCUGCUGCA
146 picture button
cbr-miR-268 miR-268 Caenorhabditis briggsae
GGCAAGAAUUAGAAGCAGUUUUGGU
105 picture button

Page 1 of 2
1 2 next >>

spacer
spacer