spacer

Target Detailed View


Hit information for ENSMMUT00000005405

Gene Name
Transcript ENSMMUT00000005405
Gene ENSMMUG00000003822
Description
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-330-5p 17.7786 -32.78 2.901520e-02 2.859830e-02 2.859830e-02 488 509
CGGAUUCUGUGUCCGGGUCUCu
| | |  :|||||||||||||
GGCAACAGCACAGGCCCAGAGt
hsa-miR-550 17.5975 -31.45 1.447860e-02 1.437430e-02 1.437430e-02 264 285
cCCGAGAAUGAGGGAGUCCGUGa
 | |||| :||||| |||||||
tGTCTCTAGCTCCC-CAGGCACa
hsa-miR-892b 17.3722 -29.45 2.016340e-02 1.996150e-02 1.996150e-02 384 405
agauggGUCUUUCCUCGGUCAC
      || :|:||||||||||
ccagaaCATGAGGGAGCCAGTG
mmu-miR-710 17.0674 -27.96 2.688740e-02 2.652920e-02 2.652920e-02 63 85
GAG-UUGAGAGGGGUUCUGAACC
||| :|  || ||| ||||||||
CTCTGAGGCTGCCCCAGACTTGG
hsa-miR-554 16.9443 -27.11 1.809030e-02 1.792770e-02 1.792770e-02 319 342
UGACCGACUCAG---UCCUGAUCG
:||| |||:| |   |||||||||
GCTGCCTGGGCCGGGAGGACTAGC
hsa-miR-150 16.7626 -32.38 4.025050e-02 3.945120e-02 3.945120e-02 586 607
GUGACCAUGUUCCCAACCCUCU
| :| |  |||||||||||:|:
CCTTTGGCCAAGGGTTGGGGGG
rno-miR-333 16.4136 -17.31 3.813910e-02 3.742100e-02 3.742100e-02 665 684
uUUUCAUUGAUCGUGUGGUg
 :||| | |  ||||||||
cGAAGGATCCTGCACACCAg
hsa-miR-323-3p 16.3319 -26.06 2.160770e-02 2.137590e-02 2.137590e-02 707 725
UCUCCAGCUGGCACAUUACAC
||||| |  |:||||:|||||
AGAGGCC--CTGTGTGATGTG
hsa-miR-499-3p 16.1531 -18.84 3.891380e-02 3.816640e-02 3.816640e-02 704 725
UCGUGUCUGAACGACACUACAa
| || ||:|    ||||||||
ACCAGAGGCCCTGTGTGATGTg
hsa-miR-631 16.1277 -18.76 4.162330e-02 4.076890e-02 4.076890e-02 557 578
CGACUCCAGACC-CGGUCCAGa
|:||| | | ||  |||||||
GTTGACGACAGGTTCCAGGTCc
hsa-miR-602 15.7771 -25.87 5.120990e-02 4.992080e-02 4.992080e-02 777 798
cCCGGCGUCGACAGCGGGCACAG
 |||: ||||  |: ||:|||||
tGGCT-CAGCCATTACCTGTGTC
hsa-miR-525-3p 15.3404 -20.41 5.093040e-02 4.965520e-02 4.965520e-02 225 247
gcGAGAUUUC-CCUUCGCGGAAg
  :|||:|:|  | ||:|||||
atTTCTGAGGTAGCAGTGCCTTa
Features
AFFY_Rhesus MmugDNA.40523.1.S1_s_at
AFFY_Rhesus MmugDNA.41280.1.S1_at
spacer
spacer