Trace format

Capillary electrophoresis trace data are presented in fasta and fastq formats and the metadata in XML format. The fastq and fasta formats are described in detail below and are available through the ENA Browser. For more details about the metadata please refer to the Trace Archive RFC.

Fastq format

The fastq file format is defined below with field descriptions:

@ENA<trace accession>|<trace name>
<bases>
+
<phred qualities, ASCII encoded starting with '!'>
Field Description
<trace accession> The Trace accession.
<trace name> The submitted provided trace name.

Example:
http://www.ebi.ac.uk/ena/data/view/TI1&display=fastq

@ENA|TI1|G10P69425RC6.T0
GGTAGGTTGTATTGGGGGNGGNGCTACNNCTTGTGTTTNGGTAGGTCTGAACTTCGGGGN
AATTNTACACAACCTAGNAAANAGTCTACCTTAAAGGTGTTTCATCTCCACCTCTGATTT
TGCAAAACTCAGATTCCTTCTCAGCAACCCAAAGGTGGAGCCCGGACTAGATCGCTAGAT
TGACCTTATACGGGATGGCCAACACTCCTGATGTGCCCCACTAGAGGATCTATCTGCCTG
GACATACATATGGGCGAACTGCAACTGACCAAAGACAGCACTCGCGGGAGTATACTGCTA
TGGACACCTGTGCAATATGTATAAGCTCTACGGAAAGTGTGCATTGTTCAATACTACCTT
ATTTCACCCAACTAACTTATTGTGCTTTCTGATACATCACTAATAAGGATATTTGGGATA
ACTGGAAATTCCTATAACTTGCTTTTCTCACACATCAGAACAAAGGAGCTCTCTGGTCTA
CGTTACAAAGACAGTGCTGAGGGCCAGAGATTACCTTCACATTTTCATGAAACAAACTCA
TACATGCTTCTTTTTTATATATCCGGTCTGCGATCCCACATGACTCTGAACGTATGAATC
ATTAAACAAGAATTCTAAAGCGCTCTTGCTTTACTAATAACAGGAGCTCGAACGTGCATC
TACTAGTTTGGTCTGACTAAGAGAGATTCTACCTCAGGGATGAGAACCGACAGCTNTGAG
TGAAGAGGCATTATCAAAAGGACACAAGCGTTACGCTGTCCTCTGACAT
+
''%''')%%%%(.%!%!%'(%!!%,)))%'%!%%%%%%'''%%++%!
%))%!%(%%%%)%!%/%!%)0/,)')0))''))''(')+/******-))))))++
*-)))***1+--3+*))***+-()***,./))''))-3883/-***2*+--,/--...++
**,,2/.,)))**-6..-+*,+..,+..**'')*111++)))))),+-+++..33NNN=.
.***-+++33-,++++++,6/0/8/***,,/.1.--**++.*+.++,,+++*/***/0,+
*--088/-----,,3/316,-+++,,+++****,,,++++**+**-+++++0+--///.-
..1*))0*,,,-**+++2,,--.1-*****//4,+-+++,/355.+,+//33331++,-+
./0+.+-0+++*,+++5/++/5655+))*45==<3++**))))(()+++))))))***))
'')))''(-2*******)*++.+,++*****''),----.,+*))*))''))+)**,**1
+++++*++/,--.4-.,,,,,..-.--++++++3-,/-++++****)0,*))+86++)))
+)*++-/)).)*05(())*))((/0+**++*)))))**((-*('''))*+)*,,,,((()
***))**671**))))**+-28+**(((,+,++**(((*('''**(*(((*,,/%!%(
(*)(**((()))-(((((((*,,,,)),*)***'',''(()(((,,)))

 

Fasta format

The fasta file format is defined below with field descriptions:

ENA<trace accession>|<trace name>
<bases>
Field Description
<trace accession> The Trace accession.
<trace name> The submitted provided trace name.

Example:
http://www.ebi.ac.uk/ena/data/view/TI1&display=fasta

>ENA|TI1|G10P69425RC6.T0
GGTAGGTTGTATTGGGGGNGGNGCTACNNCTTGTGTTTNGGTAGGTCTGAACTTCGGGGN
AATTNTACACAACCTAGNAAANAGTCTACCTTAAAGGTGTTTCATCTCCACCTCTGATTT
TGCAAAACTCAGATTCCTTCTCAGCAACCCAAAGGTGGAGCCCGGACTAGATCGCTAGAT
TGACCTTATACGGGATGGCCAACACTCCTGATGTGCCCCACTAGAGGATCTATCTGCCTG
GACATACATATGGGCGAACTGCAACTGACCAAAGACAGCACTCGCGGGAGTATACTGCTA
TGGACACCTGTGCAATATGTATAAGCTCTACGGAAAGTGTGCATTGTTCAATACTACCTT
ATTTCACCCAACTAACTTATTGTGCTTTCTGATACATCACTAATAAGGATATTTGGGATA
ACTGGAAATTCCTATAACTTGCTTTTCTCACACATCAGAACAAAGGAGCTCTCTGGTCTA
CGTTACAAAGACAGTGCTGAGGGCCAGAGATTACCTTCACATTTTCATGAAACAAACTCA
TACATGCTTCTTTTTTATATATCCGGTCTGCGATCCCACATGACTCTGAACGTATGAATC
ATTAAACAAGAATTCTAAAGCGCTCTTGCTTTACTAATAACAGGAGCTCGAACGTGCATC
TACTAGTTTGGTCTGACTAAGAGAGATTCTACCTCAGGGATGAGAACCGACAGCTNTGAG
TGAAGAGGCATTATCAAAAGGACACAAGCGTTACGCTGTCCTCTGACAT

Latest ENA News

20 Aug 2014: Read data through Globus GridFTP
Read data can now be downloaded using Globus GridFTP through ebi#ena Globus Online public endpoint.

18 Aug 2014: Changes to SRA XML 1.5
Small changes to Experiment XML, Analysis XML, EGA Dataset XML, EGA DAC XMLs were deployed on 11th of August 2014.

1 Jul 2014: ENA release 120
Release 120 of ENA's assembled/annotated seqences now available

23 May 2014: Change to date format for advanced search
From 16th June 2014, the date format used in the advanced search will be changed to ISO format (YYYY-MM-DD).

20 May 2014: Update to the ENA SAMPLE checklist
From 10th of June 2014 the ENA SAMPLE checklist XML will be updated and the older version will be deprecated.