Updating your data

2. Sequence updates:

If you are submitting a sequence update, you must provide the complete updated sequence and not only the part to be revised.
You must also provide revised feature locations if these are affected by the sequence update.

Example:

Reason for change.
Additional 5' sequence available

Data Presently in the field.
CAATTGCGGAGTCAATTTGTT
CDS <1..>21

Proposed change.
ATGCAATTGCGGAGTCAATTTGTT
CDS 1..>24

3. Citation updates:

Please provide full citation information (authors, title, journal, volume, pages, and year) for citation updates.

4. Updates to more than one entry:

If your update affects a range of accession numbers (common for citation updates), you can enter the whole range into "Accession Number(s)" field (eg. "AJ100000-AJ100010").

5. Feature table updates:

If your update affects features of the sequence, please check feature table document and EMBL Features & Qualifiers for help.

6. Third party updates:

If you spot errors or inconsistencies in database entries not owned by yourself, first try contacting the authors so that they can update their entries directly. If you are unsuccessful, then indicate that this is a third party update.

7. Updates to genome project entries:

Under NO circumstances should these be submitted via this page. Please read the section "Detailed submission procedure" here for information on how to update genome project entries.

Contact