Allele Report for 3DP1*007


3DP1*007
Previous Designations & Local Names: 3DP1Yucpa
IPD Acc No: KIR00309
Assigned: 05-MAR-2008 Sequence Last Modified: 21-MAY-2010
Source Entries: EU482062 , GU182353  
Cells Sequence Derived From: GRC-212 , YucpaB1  
Known Ethnic Origin Of Source: American Indian
Publications
Gendzekhadze K et al. Proc Natl Acad Sci U S A 106:18692-18697 2010. abstract
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
Protein Sequence (0 aa)
Nucleotide Sequence Data (949 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTG
GGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGGTGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTT
TTCATAGGCCCTGTGACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTC
AGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGG
TGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAG
TTTAATGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCA
AGACCTTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGG
ACATCGTGATTACAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTG
ACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGAGGGGGAGGCTCATGAACTTAGGTTCCC
TGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCT
TCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTTTCTGTCACAG
Genomic Sequence Data (5713 bps)
GTTCGGGAGGTTGGATCTGAGACGTGTTGTGAGTTGGTCATAGTGAAGGACGTGAGGTGCCAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCAAGCATCCACTGGGCCTCATGCAAGGTAGAAAGAGCCTGCGTACGTCACCCT
CCCATGATGTAGTCAACATGTAAGCTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCTGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAAGGAAT
AGAGGGAGGGAGCGCGGGGATGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTATGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTGGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGTCTGGAGTGG
AGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATAGGAACCTGGAGGGGAGA
TATGAGCCTGGAGTGAAGATATTGGCCTGGGATGGAGATATAGGCCTGGAGTGGAGACATGGGCCTGGAGGTGGAGATAT
GGGCCTGGAGGTGGAGACATGGGCCTAGAGGTGGATATCTGGGCCTGGAGTGGACATATGGGCCTAGGATGGAGATATGG
GCCTGGGTGTGGAGATATGGGCTTGGGGTGGAGATATGGGCCTGGATTGGAGATATGGGTCTAGGGTGGAAATATTGGCC
TGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCTTGGGGTGGGGATAGGGGCCTGGGGTGCGGATATGGGCCTGCA
GGCTGGGTCTCTACACAGCCGACAGCCCTGTTCTTGGGTGCAGGCTGGCACTGAGGGTGAGTTTCCCTTCAGCCCAGCAA
GGGCCTGGCTACCAAGACTCACAGCCCAGTGGGGGCAGCAAGGGAGTCCTGGTTTGCCTGCAGATGGATGGTCCATCATG
ATCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTAGGGTGTCA
TCTCCCCACATAAGAGGATTTTCCTGAAACAGGAGGGAAGCCCGGTGGGGGATTTTCTTATAAACAAGGATGAGGAGACC
CTGGGGTGCTCAGCCCACAGTTCCGACCTTGCCCTCCCCAGCCTTCCTTTCCCTTGGCTGAGTCAGGTTCTGTGGGAACC
CGGGAGGGTAGACTGGGGTCCTCCAAGCTGGGCTGTGCGGCTGGGATGTGGTGTCACTGGCAGAGGAAGGGAGCAAAGCA
GTGCTAGGAACAGCAGGCCTCTGAGGACAAAGGTGTAACTCACACCCTCCAGCGTTTCCATGACGGTAGGGGCTGCAGTG
TGGCTGCTGTCATTCTACCTCAGAGGTGGGGGAACCCCAGCCAGGGCCCTGACCTTCCAAATCCTCTGTTGGGGGCTCAG
TTGTGTATTGTGGTTCACACATTGGCTGATATTCCATTCACAAAGAACATGCCCTCGACTCCATGTCTATTTGTGTTGTT
TTATGTGAGTAATCTTGCAGGATTAAAATCTAGTAGGAGTCCCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTT
TTGTTGTAGAGAGACGCCAAGTCTATGCGGGGTGGGTCCTTCCTGTAGCCCTGGGCACCCAGGTGTGGTAGGAGCCTTAG
AAAGTGGAAATGGGAGAATCTTCTGACACGTGGAGGGAGGGGCGGCTCCACATCCTCCTCTCTAAGGTGGCGCCTCCTTC
TCCCCCAGGTGGTCAGGACAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTC
AGTGTCGCTCTCGTCTTGGGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGGTGCCTGTCCCTGAGCTCTACAACAGA
GTATTCCGAAACACCGTTTTCATAGGCCCTGTGACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACA
CTTCCTCACTGGGTGGTCAGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTC
CTTGTCCCACCTCCTGAGTCCCAGAGCTTCTGGTGGGAGTGTCCACCAGCGTCCCATCATCCAGACCCTAACTGTATTTG
GGGTAAAAGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGAAAGAATAATTGTCCCCAATGATGACTGCATTCTAAT
CCCTGCAGTCTGTGACTATTTATGTTATAGGGGAAGGCACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAGTTGACCTTG
AGATGGGGAGACAGCCTGGACTGTCCTGCTGGGCTCAGTGTAATCACAAGGGTGCACATGAGAGGAGAAGGAAGAGGGGA
GTGGCGATTAGAGCAGTGCAATGGAAGTCTCCATCAGCTTTGAAGGTGGAGGAAGGCCATGAGCCATGAATGCAGGTGGC
CTATAGAGGCTGGAAAAGTCAAGGAACTGATTCTCCTGGGTCTCCAGAGGGAACGCAGCCCTGCAGATGCCTTGATTTTA
GCCCTCAAAAAACAGGGTCCGATTTCTGTCTCCAGAAACGGAAGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGA
TAATTTTCTACAGCACCAACAGGAAACCAACACTGGAACCCAGGTCAAGGACAAGATAAGAAAGGACACAAGGATAGCCG
GGCGTGGTGGCAGGTGCATGTAATCCTAGCAACTCAGGAGGCTGAGGGCAGGAGAATCACTTGAACCCAGGAGACAGAGG
TTGCAGTGAGCCTAGACCACACCACTTCACTCCAGCCTGGGTGAAGGAGTGAGACTCTGACTCCAAAATTAATTAATTAA
TTAAAGAAACCAAACAAAGAGAAGGTTGGCTACACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCAT
CCACATAGGGAGGGGTTGATACTCCTCAAACCAGCACCAGAAGCCAGCCTATGGAAGCTGGCACCATGGAGAAGGCACAG
GCATGGCAAGAGTGGCTCCCAGTCCCCACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATAC
CTTCTGCCAAGGATTCCAATTCGTCCAAAAGAGATTGAACCAGTCTGCTAAGAGCCTGGACGTGCAGCCTATCCTGGTTC
CTCTTCCACCCCCACATAGAAGCAGGAAAGACATTAGTTCGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAG
CGGCAAGGGAATCAGGAGCTACTAGAGACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGTACCAGGAG
TTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGATAAGACACCAGCGAGGGGAAGCCTCACTCATT
CTAGGTGCCATGGATGGGATGATAAAGAGAGATGCCTTCTAAAGTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCT
TCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGA
GCACTTCCTTCTGCACAGAGAGGGGAAGTTTAATGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGG
CCAACTTCTCCATCGGTCGCATGACGCAAGACCTTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTAT
CAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTGATTACAGGTGAGAGTGTCTGGACATTATTCTCATTGTCACTGGG
ACACAGAGTGAATGATCCACGACTTGGAGGCCCAGGTGGTTATAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACT
AATTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAGAC
ACAGGGGCCATACAGGGAGTTAGAAAAGACAGAAAGAGTTAAAGGAGACACAGACAGACATGTGCCAGAGAGAGGTGTCC
TTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACTTCCACAAAGTGTTCTCTACC
AGAAGAACCCAAGGACACCCATATTTCTGGCCTGAGTTGGGCCCTGTGGCCTCAGGCCTTCTGGCACCTACAGATGCCGT
GTTTATTCTGACACCTCTGCCTTCCATGCAATGGAGAGTAATCGTCCCAGGATATCATGGCCCCAGAGCATCAACCCCTG
TATACTGTGTGAACTTGCGGTCCCCAGACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATGAGAGGATCACTG
AGAGACACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACACACAGAGAATGAGCCAGAGGAAGGAGATTGAG
AGACTCACAGACACATAAAGAGGGAGAAAAGAGGGCAGAGAAGTGGAGAGAACAATGGAAGGGAACAGAGAAAAGCACTA
AAATTAGAGTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAA
CTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATATAGATAGATGATAAATAGGTAGATGATAGATA
ATAGGTTATAGATACATAGATGATGATCGATTCATTCATTGATTAATCGATGATACATAGAGATGATGAAGATGAAGATA
GATAGATAATACATAGAGATAGAGAGGCAGACAAAGAGAAATCATAGAGAGAGAGAGATGATACATAGATATAGATAATA
GATGATTTTTGGATAGACAATTGATAGATAAATAGATTATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGC
ACCAGATAGATAAATAGATATATCGATAGATAATAGATAGAAATATGCAGAAAGTTATGAACAGGACACAAAGTGAGAAA
CTCAGAATTTAAAAAAAGTAACATCAAGTCAACTAGTCCAAGGAGAGTCAGAGAGAATAAAACAATCCAAAAAGGGAAAA
CATATCTAGAGGTGAGAAAGTGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGGAAAGAGGAAATAGACATAAAGAGAGA
TGGTGTGGAGGGTGAGACAGAGAGAGAGAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCTCAGCTCAGGTGGGAGGGGA
GTTGTGACAAGGAAGAACCTCCCTGAGGAAACTGCCTCTTCTCCTTCCAGGTCTATGTGGGAAACCTTCTCTCTCAGCCC
AGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTA
TCAAGGGAGGGGGAGGCTCATGAACTTAGGTTCCCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCT
GGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTG
ACCCACTGCTTGTTTCTGTCACAGGTGAGGAAA

IPD-KIR