Allele Report for 3DP1*006


3DP1*006
Previous Designations & Local Names: KIR3DP1*CU459006
IPD Acc No: KIR00269
Assigned: 20-DEC-2007 Sequence Last Modified: 21-MAY-2010
Source Entries: CU459006 , GU182338 , GU182346  
Cells Sequence Derived From: COX , FH05 , FH15  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 3 Laboratories: 2
Protein Sequence (0 aa)
Nucleotide Sequence Data (913 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGGTCAGGACAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGT
GTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGA
TGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTGACCCCAGCACATGCAGGGACC
TACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCCCCTGGTGATCATGGTCACAGG
AGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGT
CAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGACGTTTAATGACACTTTGCGCCTCACTGGAGAGCTCCAT
GATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACCTTGCAGGGACCTACAGATGCTACGGTTCTGT
TCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTGATTACAGGTCTATGTGGGAAACCTTCTC
TCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATC
TACCATCTATCAAGGGACGGGGAGGCTCATGAACTTAGGCTCCCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAA
CTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAG
ACCTTAGTGACCCACTGCTTGTTTCTGTCACAG
Genomic Sequence Data (4240 bps)
GTTCGGGAGGTTGGATCTGAGACGTGTTGTGAGTTGGTCATAGTGAAGGACGTGAGGTGCCAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCAAGCATCCACTGGGCCTCATGCAAGGTAGAAAGAGCCTGCGTACGTCACCCT
CCCATGATGTAGTCAACATGTAAGCTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAAGGAAT
AGAGGGAGGGAGTGCCACATCCTCCTCTCTAAGGTGGCGCCTCCTTCTCCCCCAGGTGGTCAGGACAAGCCCTTCCTCTC
TGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCA
GTCTGTCCAAAGAAGACGGGATGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTG
ACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCC
CCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAGTCCCAGAGCTTCTGG
TGGGAGTGTCCACCAGCGTCCCATCATCCAGACCCTAACTGTATTTGGGGTAAAAGGGGATTGAATACAGGGAAATGGGT
GCTGTGGTGGAAAGAATAATTGTCCCCAATGATGACTGCATTCTAATCCCTGCAGTCTGTGACTATTTATGTTATAGGGG
AAGGCACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCTGCTGGG
CTCAGTGTAATCACAAGGGTGCACATGAGAGGAGAAGGAAGAGGGGAGTGGCGATTAGAGCAGTGCAATGGAAGTCTCCA
TCAGCTTTGAAGGTGGAGGAAGGCCATGAGCCATGAATGCAGGTGGCCTATAGAGGCTGGAAAAGTCAAGGAACTGATTC
TCCTGGGTCTCCAGAGGGAACGCAGCCCTGCAGATGCCTTGATTTTAGCCCTCAAAAAACAGGGTCCGATTTCTGTCTCC
AGAAACGGAAGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCCACAGCACCAACAGGAAACCAACAC
TGGAACCCAGGTCAAGGACAAGATAAGAAAGGACACAAGGATAGCCGGGCGTGGTGGCAGGTGCATGTAATCCTAGCAAC
TCAGGAGGCTGAGGGCAGGAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGAGCCTAGACCACACCACTTCACTCC
AGCCTGGGTGAAGGAGTGAGACTCTGACTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTAC
ACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCA
GCACCAGAAGCCAGCCTATGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCCACCAGG
AACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTTCTGCCAAGGATTCCAAATCGTCCAAAAGAG
ATTGAACCAGTCTGCTAAGAGCCTGGACGTGCAGCCTATCCTGGTTCCTCTTCCACCCCCACATAGAAGCAGGAAAGACA
TTAGTTCGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGCGGCAAGGGAATCAGGAGCTACTAGAGACAGAG
GGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGTACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGA
GAGGAAGGAGAGAGATAAGACACCAGCGAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGAT
GCCTTCTAAAGTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAA
TCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGACGTTTAA
TGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACC
TTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATC
GTGATTACAGGTGAGAGTGTCTGGACATTATTCTCATTGTCACTGGGACACAGAGTGAATGATCCACGACTTGGAGGCCC
AGGTGGTTATAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTAACTTGGTGAGGTCTGTACCAACAGAGACAGAG
AAACAGGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACAGGGAGTTAGAAAAGACAGA
AAGAGTTAAAGGAGACACAGACAGACATGTGCCAGAGAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACA
GGTTAGAAGTTTCATTTCTGTTTTACTTCCACAAAGTGTTCTCTACCAGAAGAACCCAAGGACACCCATATTTCTGGCCT
GAGTTGGGCCCTGTGGCCTCAGGCCTTCTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGCAATG
GAGAGTAATCGTCCCAGGATATCATGGCCCCAGAACATCAACCCCTGTATACTGTGTGAACTTGCGGTCCCCAGACTGGA
TTCTGAGGCTCACATTCCAAATAACCCCACATATGAGAGGATCACTGAGAGACACAGAGAGAAATCAGGGACACCAAAAA
GCAAAGACATAAACACACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGGGAGAAAAGAG
GGCAGAGAAGTGGAGAGAACAATGGAAGGGAACAGAGAAAAGCACTAAAATTAGAGTCCTGAGGGAGAGACACAAGGACA
TAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATG
ATAGATGGATAGATATAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTC
ATTCATTGATTAATCGATGATACATAGAGATGATGAAGATGAAGATAGATAGATAATACATAGAGATAGAGAGGCAGACA
AAGAGAAATCATAGAGAGAGAGAGACGATACATAGATATAGATAATAGATGATTTTTGGATAGACAATTGATAGATAAAT
AGATTATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCAAATAGATAAATAGATATATCGATAGATAA
TAGATAGAAATATGCAGAAAGTTATGAACAGGACACAAAGTGAGAAACTCAGAATTTAAAAAAAGTAACATCAAGTCAAC
TAGTCCAAGGAGAGTCAGAGAGAATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGAGAAAGTGAGGTCAGAGAC
CTAGAGAGACAGAGAAGGTGGAAAGAGGAAATAGACATAAAGAGAGATGGTGTGGAGGGTGAGACAGAGAGAGAGAGCAT
TAGGCCATAGAGCAGGGGAGTGAGTTCTCAGCTCAGGTGGGAGGGGAGTTGTGACAAGGAAGAACCTCCCTGAGGAAACT
GCCTCTTCTCCTTCCAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCG
TGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGACGGGGAGGCTCATGAACTTAGGCTC
CCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATG
CTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAA

IPD-KIR