Allele Report for 3DP1*0030402


3DP1*0030402
Previous Designations & Local Names: 3DP1_FH13_BA2_hap
IPD Acc No: KIR00629
Assigned: 31-MAR-2010 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182345  
Cells Sequence Derived From: FH13  
Known Ethnic Origin Of Source: Black
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (913 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGGTCAGGACAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGT
GTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGA
TGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTGACCCCAGCACATGCAGGGACC
TACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCCCCTGGTGATCATGGTCACAGG
AGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGT
CAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAATGACACTTTGCGCCTCACTGGAGAGCTCCAT
GATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACCTTGCAGGGACCTACAGATGCTACGGTTCTGT
TCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTGATTACAGGTCTATGTGGGAAACCTTCTC
TCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATC
TACCATCTATCAAGGGAGGGGGAGGCTCATGAACTTAGGTTCCCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAA
CTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAG
ACCTTAGTGACCCACTGCTTGTGTCTGTCACAG
Genomic Sequence Data (4240 bps)
GTTCGGGAGGTTGGATCTGAGACGTGTTGTGAGTTGGTCATAGTGAAGGACGTGAGGTGCCAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCAAGCATCCACTGGGCCTCATGCAAGGTAGAAAGAGCCTGCGTACGTCACCCT
CCCATGATGTAGTCAACATGTAAGCTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAAGGAAT
AGAGGGAGGGAGTGCCACATCCTCCTCTCTAAGGTGGCGCCTCCTTCTCCCCCAGGTGGTCAGGACAAGCCCTTCCTCTC
TGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCA
GTCTGTCCAAAGAAGACGGGATGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTG
ACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCC
CCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAGTCCCAGAGCTTCTGG
TGGGAGTGTCCACCAGCGTCCCATCATCCAGACCCTAACTGTATTTGGGATAAAAGGGGATTGAATACAGGGAAATGGGT
GCTGTGGTGGAAAGAATAATTGTCCCCAATGATGACTGCATTCTAATCCCTGCAGTCTGTGACTATTTATGTTATAGGGG
AAGGCACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCTGCTGGG
CTCAGTGTAATCACAAGGGTGCACATGAGAGGAGAAGGAAGAGGGGAGTGGCGATTAGAGCAGTGCAATGGAAGTCTCCA
TCAGCTTTGAAGGTGGAGGAAGGCCATGAGCCATGAATGCAGGTGGCCTATAGAGGCTGGAAAAGTCAAGGAACTGATTC
TCCTGGGTCTCCAGAGGGAACGCAGCCCTGCAGATGCCTTGATTTTAGCCCTCAAAAAACAGGGTCCGATTTCTGTCTCC
AGAAACGGAAGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCACCAACAGGAAACCAACAC
TGGAACCCAGGTCAAGGACAAGATAAGAAAGGACACAAGGATAGCCGGGCGTGGTGGCAGGTGCATGTAATCCTAGCAAC
TCAGGAGGTTGAGGGCAGGAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGAGCCTAGACCACACCACTTCACTCC
AGCCTGGGTGAAGGAGTGAGACTCTGACTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTAC
ACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCA
GCACCAGAAGCCAGCCTATGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCCACCAGG
AACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTTCTGCCAAGGATTCCAATTCGTCCAAAAGAG
ATTGAACCAGTCTGCTAAGAGCCTGGACGTGCAGCCTATCCTGGTTCCTCTTCCACCCCCACATAGAAGCAGGAAAGACA
TTAGTTCGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGCGGCAAGGGAATCAGGAGCTACTAGAGACAGAG
GGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGTACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGA
GAGGAAGGAGAGAGATAAGACACCAGCGAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGAT
GCCTTCTAAAGTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAA
TCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAA
TGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACC
TTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATC
GTGATTACAGGTGAGAGTGTCTGGACATTATTCTCATTGTCACTGGGACACAGAGTGAATGATCCACGACTTGGAGGCCC
AGGTGGTTATAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTAACTTGGTGAGGTCTGTACCAACAGAGACAGAG
AAACAGGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGA
AAGAGTTAAAGGAGACACAGACAGACATGTGCCAGAGAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACA
GGTTAGAAGTTTCATTTCTGTTTTACTTCCACAAAGTGTTCTCTACCAGAAGAACCCAAGGACACCCATATTTCTGGCCT
GAGTTGGGCCCTGTGGCCTCAGGCCTTCTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGCAATG
GAGAGTAATCGTCCCAGGATATCATGGCCCCAGAACATCAACCCCTGTATACTGTGTGAACTTGCGGTCCCCAGACTGGA
TTCTGAGGCTCACATTCCAAATAACCCCACATATGAGAGGATCACTGAGAGACACAGAGAGAAATCAGGGACACCAAAAA
GCAAAGACATAAACACACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGGGAGAAAAGAG
GGCAGAGAAGTGGAGAGAACAATGGAAGGGAACAGAGAAAAGCACTAAAATTAGAGTCCTGAGGGAGAGACACAAGGACA
TAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATG
ATAGATGGATAGATATAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGATTGATTC
ATTCATTGATTAATCGATGATACATAGAGATGATGAAGATGAAGATAGATAGATAATACATAGAGATAGAGAGGCAGACA
AAGAGAAATCATAGAGAGAGAGAGACGATACATAGATATAGATAATAGATGATTTTTGGATAGACAATTGATAGATAAAT
AGATTATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCAAATAGATAAATAGATTTATCGATAGATAA
TAGATAGAAATATGCAGAAAGTTATGAACAGGACACAAAGTGAGAAACTCAGAATTTAAAAAAAGTAACATCAAGTCAAC
TAGTCCAAGAAGAGTCAGAGAGAATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGAGAAAGTGAGGTCAGAGAC
CTAGAGAGACAGAGAAGGTGGAAAGAGGAAATAGACATAAAGAGAGATGGTGTGGAGGGTGAGACAGAGAGAGAGAGCAT
TAGGCCATAGAGCAGGGGAGTGAGTTCTCAGCTCAGGTGGGAGGGGAGTTGTGACAAGGAAGAACCTCCCTGAGGAAACT
GCCTCTTCTCCTTCCAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCG
TGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGAGGGGGAGGCTCATGAACTTAGGTTC
CCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATG
CTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTGTCTGTCACAGGTGAGGAAA

IPD-KIR