Allele Report for 3DP1*0030205


3DP1*0030205
Previous Designations & Local Names: 3DP1_ABC08_ABhapTA
IPD Acc No: KIR00627
Assigned: 31-MAR-2010 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182361 , GU182362  
Cells Sequence Derived From: ABC08  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (913 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGGTCAGGACAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGT
GTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGA
TGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTGACCCCAGCACATGCAGGGACC
TACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCCCCTGGTGATCATGGTCACAGG
AGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGT
CAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAATGACACTTTGCGCCTCACTGGAGAGCTCCAT
GATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACCTTGCAGGGACCTACAGATGCTACGGTTCTGT
TCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTGATTACAGGTCTATGTGGGAAACCTTCTC
TCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATC
TACCATCTATCAAGGGAGGGGGAGGCTCATGAACTTAGGTTCCCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAA
CTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAG
ACCTTAGTGACCCACTGCTTGTTTCTGTCACAG
Genomic Sequence Data (4240 bps)
GTTCGGGAGGTTGGATCTGAGACGTGTTGTGAGTTGGTCATAGTGAAGGACGTGAGGTGCCAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCAAGCATCCACTGGGCCTCATGCAAGGTAGAAAGAGCCTGCGTACGTCACCCT
CCCATGATGTAGTCAACATGTAAGCTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAAGGAAT
AGAGGGAGGGAGTGCCACATCCTCCTCTCTAAGGTGGCGCCTCCTTCTCCCCCAGGTGGTCAGGACAAGCCCTTCCTCTC
TGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACGAATTCA
GTCTGTCCAAAGAAGACGGGATGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGCCCTGTG
ACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAGCAACCC
CCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAGTCCCAGAGCTTCTGG
TGGGAGTGTCCACCAGCGTCCCATCATCCAGACCCTAACTGTATTTGGGGTAAAAGGGGATTGAATACAGGGAAATGGGT
GCTGTGGTGGAAAGAATAATTGTCCCCAATGATGACTGCATTCTAATCCCTGCAGTCTGTGACTATTTATGTTATAGGGG
AAGGCACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCTGCTGGG
CTCAGTGTAATCACAAGGGTGCACATGAGAGGAGAAGGAAGAGGGGAGTGGCGATTAGAGCAGTGCAATGGAAGTCTCCA
TCAGCTTTGAAGGTGGAGGAAGGCCATGAGCCATGAATGCAGGTGGCCTATAGAGGCTGGAAAAGTCAAGGAACTGATTC
TCCTGGGTCTCCAGAGGGAACGCAGCCCTGCAGATGCCTTGATTTTAGCCCTCAAAAAACAGGGTCCGATTTCTGTCTCC
AGAAACGGAAGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCCACAGCACCAACAGGAAACCAACAC
TGGAACCCAGGTCAAGGACAAGATAAGAAAGGACACAAGGATAGCCGGGCGTGGTGGCAGGTGCATGTAATCCTAGCAAC
TCAGGAGGCTGAGGGCAGGAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGAGCCTAGACCACACCACTTCACTCC
AGCCTGGGTGAAGGAGTGAGACTCTGACTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTAC
ACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCA
GCACCAGAAGCCAGCCTATGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCCACCAGG
AACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTTCTGCCAAGGATTCCAATTCGTCCAAAAGAG
ATTGAACCAGTCTGCTAAGAGCCTGGACGTGCAGCCTATCCTGGTTCCTCTTCCACCCCCACATAGAAGCAGGAAAGACA
TTAGTTCGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGCGGCAAGGGAATCAGGAGCTACTAGAGACAGAG
GGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGTACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGA
GAGGAAGGAGAGAGATAAGACACCAGCGAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGAT
GCCTTCTAAAGTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAA
TCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAA
TGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCAAGACC
TTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATC
GTGATTACAGGTGAGAGTGTCTGGACATTATTCTCATTGTCACTGGGACACAGAGTGAATGATCCACGACTTGGAGGCCC
AGGTGGTTATAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTAACTTGGTGAGGTCTGTACCAACAGAGACAGAG
AAACAGGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACAGGGAGTTAGAAAAGACAGA
AAGAGTTAAAGGAGACACAGACAGACATGTGCCAGAGAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACA
GGTTAGAAGTTTCATTTCTGTTTTACTTCCACAAAGTGTTCTCTACCAGAAGAACCCAAGGACACCCATATTTCTGGCCT
GAGTTGGGCCCTGTGGCCTCAGGCCTTCTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGCAATG
GAGAGTAATCGTCCCAGGATATCATGGCCCCAGAACATCAACCCCTGTATACTGTGTGAACTTGCGGTCCCCAGACTGGA
TTCTGAGGCTCACATTCCAAATAACCCCACATATGAGAGGATCACTGAGAGACACAGAGAGAAATCAGGGACACCAAAAA
GCAAAGACATAAACACACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGGGAGAAAAGAG
GGCAGAGAAGTGGAGAGAACAATGGAAGGGAACAGAGAAAAGCACTAAAATTAGAGTCCTGAGGGAGAGACACAAGGACA
TAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATG
ATAGATGGATAGATATAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGATCGATTC
ATTCATTGATTAATCGATGATACATAGAGATGATGAAGATGAAGATAGATAGATAATACATAGAGATAGAGAGGCAGACA
AAGAGAAATCATAGAGAGAGAGAGATGATACATAGATATAGATAATAGATGATTTTTGGATAGACAATTGATAGATAAAT
AGATTATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCAGATAGATAAATAGATATATCGATAGATAA
TAGATAGAAATATGCAGAAAGTTATGAACAGGACACAAAGTGAGAAACTCAGAATTTAAAAAAAGTAACATCAAGTCAAC
TAGTCCAAGGAGAGTCAGAGAGAATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGAGAAAGTGAGGTCAGAGAC
CTAGAGAGACAGAGAAGGTGGAAAGAGGAAATAGACATAAAGAGAGATGGTGTGGAGGGTGAGACAGAGAGAGAGAGCAT
TAGGCCATAGAGCAGGGGAGTGAGTTCTCAGCTCAGGTGGGAGGGGAGTTGTGACAAGGAAGAACCTCCCTGAGGAAACT
GCCTCTTCTCCTTCCAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCG
TGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGAGGGGGAGGCTCATGAACTTAGGTTC
CCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATG
CTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAA

IPD-KIR