Allele Report for 3DP1*002


3DP1*002
Previous Designations & Local Names: KIRX
IPD Acc No: KIR00093
Assigned: 28-JUN-2003 Sequence Last Modified: 17-JUL-2003
Source Entries: AL133414  
Cells Sequence Derived From: RPCI-1  
Known Ethnic Origin Of Source: Unknown
Publications
Wilson MJ et al. Proc Natl Acad Sci U S A 97:4778-83 2000. abstract
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (949 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTCCTCTCTGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTG
GGTTTAACGAATTCAGTCTGTCCAAAGAAGACGGGATGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTT
TTCATAGGCCCTGTGACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTC
AGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGG
TGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAG
TTTAATGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGCA
AGACCTTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGG
ACATCGTGATTACAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAGAGAGCGTG
ACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGACGGGGAGGCTCATGAACTTAGGTTCCC
TGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCT
TCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTTTCTGTCACAG
Genomic Sequence Data (5437 bps)
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAAGGAATAGAGGGAGGGAGCGCGGGGATGGAGAT
CTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTATGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGATATAT
GGGCCTGGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGTCTGGAGTGGAGATATGGGCCTGGAGGTGGAGATATG
GGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATAGGAACCTGGAGGGGAGATATGAGCCTGGAGTGAAGATATTGGCC
TGGGATGGAGATATGGGCCTGGAGTGGAGACATGGGCCTGGAGGTGGAGATATGGGCCTGGAGGTGGAGACATGGGCCTA
GAGGTGGATATCTGGGCCTGGAGTGGACATATGGGCCTAGGATGGAGATATGGGCCTGGGTGTGGAGATATGGGCTTGGG
GTGGAGATATGGGCCTGGATTGGAGATATGGGTCTAGGGTGGAAATATTGGCCTGGAGTGGAGATATGGGCCTGGAGTGG
AGATATGGGCTTGGGGTGGGGATAGGGGCCTGGGGTGCGGATATGGGCCTGCAGGCTGGGTCTCTACACAGCCGACAGCC
CTGTTCTTGGGTGCAGGCTGGCACTGAGGGTGAGTTTCCCTTCAGCCCAGCAAGGGCCTGGCTACCAAGACTCACAGCCC
AGTGGGGGCAGCAAGGGAGTCCTGGTTTGCCTGCAGATGGATGGTCCATCATGATCTTTCTTTCCAGGGTTCTTCTTGCT
GCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGA
AACAGGAGGGAAGCCCGGTGGGGGATTTTCTTATAAACAAGGATGAGGAGACCCTGGGGTGCTCAGCCCACAGTTCCGAC
CTTGCCCTCCCCAGCCTTCCTTTCCCTTGGCTGAGTCAGGTTCTGTGGGAACCCGGGAGGGTAGACTGGGGTCCTCCAAG
CTGGGCTGTGCGGCTGGGATGTGGTGTCACTGGCAGAGGAAGGGAGCAAAGCAGTGCTAGGAACAGCAGGCCTCTGAGGA
CAAAGGTGTAACTCACACCCTCCAGCGTTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCATTCTACCTCAGAGGT
GGGGGAACCCCAGCCAGGGCCCTGACCTTCCAAATCCTCTGTTGGGGGCTCAGTTGTGTATTGTGGTTCACACATTGGCT
GATATTCCATTCACAAAGAACATGCCCTCGACTCCATGTCTATTTGTGTTGTTTTATGTGAGTAATCTTGCAGGATTAAA
ATCTAGTAGGAGTCCCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGAGAGACGCCAAGTCTATG
CGGGGTGGGTCCTTCCTGTAGCCCTGGGCACCCAGGTGTGGTAGGAGCCTTAGAAAGTGGAAATGGGAGAATCTTCTGAC
ACGTGGAGGGAGGGGCGGCTCCACATCCTCCTCTCTAAGGTGGCGCCTCCTTCTCCCCCAGGTGGTCAGGACAAGCCCTT
CCTCTCTGCCTGGCCCAGCCCTGTGGTGTCTGAAGGAGAACATGTGGCTCTTCAGTGTCGCTCTCGTCTTGGGTTTAACG
AATTCAGTCTGTCCAAAGAAGACGGGATGCCTGTCCCTGAGCTCTACAACAGAGTATTCCGAAACACCGTTTTCATAGGC
CCTGTGACCCCAGCACATGCAGGGACCTACAGATGTCGGGGTTCACACCCACACTTCCTCACTGGGTGGTCAGCACCCAG
CAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAGTCCCAGAGC
TTCTGGTGGGAGTGTCCACCAGCGTCCCATCATCCAGACCCTAACTGTATTTGGGGTAAAAGGGGATTGAATACAGGGAA
ATGGGTGCTGTGGTGGAAAGAATAATTGTCCCCAATGATGACTGCATTCTAATCCCTGCAGTCTGTGACTATTTATGTTA
TAGGGGAAGGCACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCT
GCTGGGCTCAGTGTAATCACAAGGGTGCACATGAGAGGAGAAGGAAGAGGGGAGTGGCGATTAGAGCAGTGCAATGGAAG
TCTCCATCAGCTTTGAAGGTGGAGGAAGGCCATGAGCCATGAATGCAGGTGGCCTATAGAGGCTGGAAAAGTCAAGGAAC
TGATTCTCCTGGGTCTCCAGAGGGAACGCAGCCCTGCAGATGCCTTGATTTTAGCCCTCAAAAAACAGGGTCCGATTTCT
GTCTCCAGAAACGGAAGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCACCAACAGGAAAC
CAACACTGGAACCCAGGTCAAGGACAAGATAAGAAAGGACACAAGGATAGCCGGGCGTGGTGGCAGGTGCATGTAATCCT
AGCAACTCAGGAGGCTGAGGGCAGGAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGAGCCTAGACCACACCACTT
CACTCCAGCCTGGGTGAAGGAGTGAGACTCTGACTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTT
GGCTACACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTC
AAACCAGCACCAGAAGCCAGCCTATGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCC
ACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTTCTGCCAAGGATTCCAATTCGTCCA
AAAGAGATTGAACCAGTCTGCTAAGAGCCTGGACGTGCAGCCTATCCTGGTTCCTCTTCCACCCCCACATAGAAGCAGGA
AAGACATTAGTTCGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGCGGCAAGGGAATCAGGAGCTACTAGAG
ACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGTACCAGGAGTTATGGGCACAGAAAAGAACATGAAGA
CACAGAGAGGAAGGAGAGAGATAAGACACCAGCGAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAG
AGAGATGCCTTCTAAAGTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTG
GTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAA
GTTTAATGACACTTTGCGCCTCACTGGAGAGCTCCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCGCATGACGC
AAGACCTTGCAGGGACCTACAGATGCTACGGTTCTGTTCCTCATTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTG
GACATCGTGATTACAGGTGAGAGTGTCTGGACATTATTCTCATTGTCACTGGGACACAGAGTGAATGATCCACGACTTGG
AGGCCCAGGTGGTTATAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTAATTTGGTGAGGTCTGTACCAACAGAG
ACAGAGAAACAGGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACAGGGAGTTAGAAAA
GACAGAAAGAGTTAAAGGAGACACAGACAGACATGTGCCAGAGAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCT
GGCACAGGTTAGAAGTTTCATTTCTGTTTTACTTCCACAAAGTGTTCTCTACCAGAAGAACCCAAGGACACCCATATTTC
TGGCCTGAGTTGGGCCCTGTGGCCTCAGGCCTTCTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCAT
GCAATGGAGAGTAATCGTCCCAGGATATCATGGCCCCAGAACATCAACCCCTGTATACTGTGTGAACTTGCGGTCCCCAG
ACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATGAGAGGATCACTGAGAGACACAGAGAGAAATCAGGGACAC
CAAAAAGCAAAGACATAAACACACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGGGAGA
AAAGAGGGCAGAGAAGTGGAGAGAACAATGGAAGGGAACAGAGAAAAGCACTAAAATTAGAGTCCTGAGGGAGAGGCACA
AGGACATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGA
CAGATGATAGATGGATAGATATAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGAT
CGATTCATTCATTGATTAATCGATGATACATAGAGATGATGAAGATGAAGATAGATAGATAATACATAGAGATAGAGAGG
CAGACAAAGAGAAATCATAGAGAGAGAGAGATGATACATAGATATAGATAATAGATGATTTTTGGATAGACAATTGATAG
ATAAATAGATTATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCAGATAGATAAATAGATATATCGAT
AGATAATAGATAGAAATATGCAGAAAGTTATGAACAGGACACAAAGTGAGAAACTCAGAATTTAAAAAAAGTAACATCAA
GTCAACTAGTCCAAGGAGAGTCAGAGAGAATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGAGAAAGTGAGGTC
AGAGACCTAGAGAGACAGAGAAGGTGGAAAGAGGAAATAGACATAAAGAGAGATGGTGTGGAGGGTGAGACAGAGAGAGA
GAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCTCAGCTCAGGTGGGAGGGGAGTTGTGACAAGGAAGAACCTCCCTGAG
GAAACTGCCTCTTCTCCTTCCAGGTCTATGTGGGAAACCTTCTCTCTCAGCCCAGCCGCGCCCCATGGTTAAGGCAGGAG
AGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATCTACCATCTATCAAGGGACGGGGAGGCTCATGAACTT
AGGTTCCCTGCAGTGCCCAAGGTCAATGGAACCTTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTA
CAGATGCTTCGGCTCTTTCCGTGACTCTCCCTACGAGTGGTCAGACCTTAGTGACCCACTGCTTGTTTCTGTCACAG

IPD-KIR