Allele Report for 3DL1*01501


3DL1*01501
Previous Designations & Local Names:
IPD Acc No:
Assigned: Sequence Last Modified:
Source Entries:  
Cells Sequence Derived From:  
Known Ethnic Origin Of Source: Unknown
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed:
Cells: 0 Laboratories:
Protein Sequence (0 aa)
Nucleotide Sequence Data (0 bps)
Genomic Sequence Data (14339 bps)
AGTGAGAGCAATTTCCAGGAAGCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAAAGAGCCTG
CGTACGTCACCCTCCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAG
CTGAGCTGGGGCGCGGCCGCCTGTCTGCACCGGCAGCACCATGTTGCTCATGGTCGTCAGCATGGCGTGTGTTGGTGAGT
CCTGGAAGGGAATCGAGGGAGGGAGTGCGGGGATGGAGATCTGGACCTGGAGGTAAAGATATGGGCCTAGAGGTGGAGTT
ATGGGCCTGGAGGTGGAGTTATGGGCCTGAAGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATAGG
GGCCTGGGGTGGAGATATGTGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGGGTGGAGATATGTGCC
TGGGGTGGAGATATGGGCCTGGAGGGGAGATATGGATGGGCCTGGAGGGGAGATGTGGGCCTAGAGGTGGAGTGATGGGC
CTAGAAGTGGAGCGATGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTATGGGCCTGCAGTAGAGATATGGGCCT
GAAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTAGAGGTGGAGTTATGGGCCCGGAGGTGGAGTTAAGGGCATGA
AGTGGAGATCTGGGCCTGGAGTGGAGATATGATCCTGGAGTGGAGATATGGGCCTGGGGTGGAGATACGGGCCTGGAGCA
GACATACAAGCCTGGAAAGGAGATATGGGCCTGGAGAGGAGATAGAAGCCTGGAGTGGAAATATGGGCCTGGAGTGGAGA
TATGAGCCTGGAGTGGATATATGAGCCTGGAGTTGAGATAGGAGCCTGGAGTGGAGATATGGGCCTGGAGTGGACTTATC
AGCCTGGAGAGGAGATATGGGTCTGGAGTGGAGATACGGACCTGGAGTGGAGATCTGGGCCTGTTGTGTAGATCTAGGCC
TGGAGGTAGAGATCTGGGCCTGGAGGCTGAGTCTCTGCACAGCCGAGATCCTTGTTCCTGGGGGCAGGTAGGCAGCGAGG
GTGAGTTTACCTTCAGCCCAGCAAGGGCCTGGCTGCCAAGACGCACAGCCCAGTGGGGGCAGCAGGGTGCCCTGGTTTGC
CTGCAGATGGATGGTCCATCATGATCTTTCTTTCTAGGGTTCTTCTTGGTCCAGAGGGCCGGTCCACACGTGGGTGAGTC
CTTCCCCAAACCTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGAAATGGGAGGGAAGTCCTGTCGGGGAGTCTC
TCATAAACTAGGAAGAGGGGACCCTCGGATGCTCGGCCCACATTTCTGACCTTGCCCTCCCCGGCCTTTCTTTCCCTTTC
CTGAGTCAAGCTCTGTGAAGACTGGGGTGAGACTAGGGTGCTCCAAGATGGGTGTGCAGGGAGGAAGTGGTGTCAGCAGC
AGAGAAAGAGAGGGAAGCAGTGCTAGGAACAGCAGGTCCTCTGAGGACAAAGGTGTAACTCACACCCTCCAGCGTTTCCG
TGATGGTAGGGGCTGCAGTGTGGCTGTGGTCTTTCTACCAGAAAAGGTGAGGAAACCACAGCCATGGCCCTGACATTCCA
AATCCTCTGATGGGGGCTCAGTTCATCAATTGGCTGATATTCCATTCACATAGGACTTGCCCTCCATGCCGTGTCTACTT
TGTGTTGTTTTATATGAGTAATTTTGCAGTATTAAAATCTAGTAAGAGTTGCTTCTCCAGCACTTGCTCAAAGTTCTCAG
CTGACACTTGTTGTAGGGAGACGCCATGTCTATGCAGGATGGGTCCTTCCTGTAGCCCTGGGCACCCAGGTGTGGTAGGA
GCCTTAGAAAGTGGAAATGGGGAGAATCTTCTGGGCACTGGGAGTGAGGGGCGGCTCCACATCCTCCTCTCTAAGGCAGT
GCCTCCTTCTCCCCCAGGTGGTCAGGACAAGCCCTTCCTGTCTGCCTGGCCCAGCGCTGTGGTGCCTCGAGGAGGACACG
TGACTCTTCGGTGTCACTATCGTCATAGGTTTAACAATTTCATGCTATACAAAGAAGACAGAATCCACGTTCCCATCTTC
CATGGCAGATTATTCCAGGAGAGCTTCAACATGAGCCCTGTGACCACAGCACATGCAGGGAACTACACATGTCGGGGTTC
ACACCCACACTCCCCCACTGGGTGGTCGGCACCCAGCAACCCCGTGGTGATCATGGTCACAGGTCAGAGGCTTTCCGTCT
GGGCTTCTCACTGTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGGGTGTCCGTCAGGGTCCCATCACCCAGGCCCTGA
CTGTATTTGGGGTCAAGGGAGATTGAATACAGGGGAAATGGGTGCTGTGGTGGGAAGAATCACTGTCCCCAATGATGGCT
ACATTGTAATCCCTGGAGCCTGTGACTATTTATGTTACAGGGCAGGGGACTGAAGGGGAAGGTGGAGCTCAGGTTGTTGA
TGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCACTGGGCTCAGTGTAATCACAAGGGTCCACATGAGAGGTG
GAGGAAGAGGGGAGTGGGGATTAGAGCAGTGTAGTGGGAGGGAGACGCTATCAGCCACTGCGGGCTTTGAAGGTGGAGGA
AGACCACTAGTCACAGAATGCAGGTGGCCTCTAAGGGCTGGAGAAGTCAAGAGAACTGATTCGCTGATTCTCCAGAGGGA
ACGCAGCCCTGTAGACACCTTGATTTCAGCACAGGGAGAACTGGATCCAATTTCTGTCTCCAGAAGTGGAAGGGGTCAGT
GTGTTCTCTCCCGCTGCCATGTTTGTGGTAATTTTCTGCAGCAGCAACAGGAAACCAACACAGGAACCCAGGTCAAGGAC
AAGTTAGGAAACCAAACAAGGATAGCCAGATGTGGTGGTGGGCGCGAGTAATCCAACGACTGGGGAGGCTGAGGCAAGAG
AATCACTTGAACTGGGGATTTGTTCAAAAGAGATTGATTCAGGCTGCTAAGAGCCTGGACATGCAGCCTGTCCTCTTCCA
CCCCCACATAGACAGCAGGAAAGAGATTAGTGGGAAACAGATACAACAGCCCAAGAGATGAGGCTGTCTTCACAGTGGCA
AGGGAGTCAGGGGCTACTGGAGACAGAGGGACAGAGAAGAGGGAGGAAGACAGATGGAGGCACCTGCACCAGGGGATATG
GGCACAGAAAAGACACGGAGATGCAGAGAGGGAGGAGAGAGACAGACACGGGGAGGGGAACCCTCACTCATTCCAGGTGC
CATGGATGGGATGATAAAGAGAGATGCCTTCTAAACTCACAACTTCTCTTTCTAGGAAACCACAGAAAACCTTCCCTCCT
GGCCCACCCAGGTCCCCTGGTGAAATCAGGAGAGAGAGTCATCCTGCAATGTTGGTCAGATATCATGTTTGAGCACTTCT
TTCTGCACAAAGAGGGGATCTCTAAGGACCCCTCACGCCTCGTTGGACAGATCCATGATGGGGTCTCCAAGGCCAATTTC
TCCATCGGTCCCATGATGCTTGCCCTTGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACACCCCCTATCAGTTGTC
AGCTCCCAGTGATCCCCTGGACATCGTGGTCACAGGTGAGAGTGTCTAGACATTGTTCTCATTGTCACTGGGACACAGAG
TGAATGATCCAGGACTTGGAACCCCCAGGTGGTCATGAGGAAGATAAGTGTGGGATTCTTATGGAAAGAGAGTGACTTGG
TGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACATAAGTACAGAACAGGTGTCATAACAGAGGACAGACACAGGGG
CCATACAGGGAGGTAGAAAAGAGAGAAAGAGGTAAAGGAGACACTCAGACAGACAGACATGTCCCAGAGAGAGGTGTCCT
TCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTGTTCCTACCAG
AAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGGCCTCAGGCCTTGTGCCACCTACAGATGCCGTGT
TTATTCTGACACCTCTGCCTTCCATGCAATGGAGAGTAATCATCCCAGGATATCATGGCCCCTGAACACCAACCCCTGTA
TGCTGTGTGAACTTGGGGTCCCCAGACTGGATTCTGAGGCTCATATTCCAAATAATCCCACATATGATAGGATCGCTGAG
AGACACAGAGAAAAATCAGGGACACCAAAAAACAAAGACATAAACACACACAAAATGAGCCAGAAGAAGGAGATTAAGAG
ATTCACAGACACATAAAAAGAAAGAAAAGAGGGCAGAATGGAGAGAATGATGGAAAGGAGGAGAGAAAAGCCCCAAAATC
AGAACCCTGAGGGAGGGACACAAAGACAGAGAAAGATAAATATGTGGGGATGGATTGCAGAGATTCCAAATAGAACTAGA
GAGACTGAGAGGCAGAGAAAGACAAGGAGACGGAGAGAGAGAGATGATAGATGGATAGATAGACGTAGATAGATGATAAA
TAGGTAGATGATAGATAATGGATTGGTTATAGATACATAGATGATGACTGATAGATGATACATAGAGATGACGATGATGA
TGATAGACACATAGATATATACATAGATGATACATAAATAGAGACAGAGAGGCAGACAGAGAGGTAATAGAGAGAGAGAT
AGATGATACATATATAGATAATAGATGATTGATGGATAGATAGACAGATAGACAATTGATAGAGAGATAGATAAGTGATA
CATAAATATAGATGATAGATAATTTGTAGATAGACACAAAATAGATAAATAGATAGAAATGTGCAGAAAGTTATGAACAA
GACAGAAAGTGAGAGACTCAAAATTAAAGAAAAAGGAAGATCAAGTCAACCAATCCAAGGAGGGTCAGAGAGAATAAAAC
AATCCAAAAAGGGAAAACATACCTCAGGGTGGGGAAGTGAGGTCATAGACCTAGAGAGACAGAAAAGGTAGAAGGAGGAA
ACAGATATGAAGAGAGATGGGGTGGAGGGTGAGAGAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGGAGTGAGTTCTCA
GCTCAGGTATGAGGGGAGCTATGACAAGGAAGAACCTCCCTGAGGAAACTGCCTCTTCTCCTTCCAGGTCCATATGAGAA
ACCTTCTCTCTCAGCCCAGCCGGGCCCCAAGGTTCAGGCAGGAGAGAGCGTGACCTTGTCCTGTAGCTCCCGGAGCTCCT
ATGACATGTACCATCTATCCAGGGAGGGGGGAGCCCATGAACGTAGGCTCCCTGCAGTGCGCAAGGTCAACAGAACATTC
CAGGCAGATTTCCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTCACTCTCCCTACGA
GTGGTCAGACCCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGAAAAGCCCATATCTCTCTCATGTCCTATGATCCT
AAATCCTTAGCTAAGGAGCTTCCTGCTGATGATGGAGAAAAGCATGGACAGATGCAGAGAGAAGACACAGCAGGTGTGAG
GGCGGAGTCAGGGCGCAGGATGGCAGACAGGGCACCTCCAAACCCTCCTTCATGGCCTGCATGGAGGCCTCCGATCAGGG
CTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGACAGACCCAGAGAAGGGGAGACTGGGCTTAGTTTGGGGAGATCA
GAGGTTCCCTCAGCCCCTCAATCTTATCCATTTCCCAGAAGCCCATCATGGCCTCTCACCCACACAGAGAGATATCATCA
CCAGCAACCCCTACACCCTTTTCTTTTCATTTTCAAAAATATTTATTGAGGTTAAATGTAACTATATAATTTACCACCTT
TACCATTTTTAAAAGTAAAATCTAGTGGTCATAAATACCTTTATATGCTGGGTGTGGTGGTTCACGGTTGTAATCTCGGC
GCTTTGAGAGGCCAAGGAAGGTGGATCATTTAAGATCAGGAACTCGAGATCACCCTGGCCAACATGTGGGAAATTCATCT
TTACTAAACAGACAAGAAAAATTAGCCGAGCATGCTGGCATGCACCTGTAGTCCTAGCTACTTGGGAGGCTGAGGCAGGA
GAAGCACTTAAACCCAGGAGGCAGAGGTTGCACTGAGCCGAGATCATGCCACTGCACTGCAGCCTGGGAGACAGAGAGAG
ACTCTGTTTCTAAATAAATAAATACATCTATATTCTTTTTTTTGTTACCCTCCACCCTTCCCTTCCTGGCCTCTGGTGTC
CACCATTGTATTCTCCACCTTCATGAGATCCACCTTTTATCTCCTGCATGTGGGTGAGAAATGGGAATCTTTGTAATGAC
CTCCAGTTCCATCCATGTGGCTGCAAATGACAGGATGTTATTGTTTCTATGGATGAGTAGTCTCCACTGTGTGTGTGTAC
CACAGTTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTGAACAGTGCTGGAACA
GTCATATGAGTGCAGATATCACTTCGATACACTGATGTCCTTTCCTTTGGATATAAACCCAGTAGTGAAATTGCTGGACA
CTATGAAAGTTCTCTTTTTTTTTTTTTCTTTTTTGAGAAAGAGTTTCCCTCCTTAGTCCAAGCTGGAGTCTAAGTGGTGA
GATCTTGGCTCATTGCAACCTGTGCCTCCTAGGTTCAAATGATTGTCCTGACTCAGCCTCCCTAGTAGCTGTGATTACAG
GTGCACGCCACCATGCCTGGCTAATTTTTGTATTTTTTTAGCACAGACGGGATATCCCAATTTTGGGCAGGCTGCTCTCA
AACTCCTGACCTCAAGTGAGGTGCCTGCCTCGGTTTCCCAAAGTGCTGAAGTTACAGGCATAAGCCACTATGCCCAGCCT
CCTTTTAGTTTTTTAAAGAATTTCCATACTTTTCTCCATAATAGTTGTACTAATTTACATTCCTACCAACAGGGTACCAG
GGTTCTCCTTTCTCTACCATCTTGCCAGCATTTGTTTTGCCTGTCTTGCAGTAAAAGCCATTTTACTTTACTTTATTTTA
TTTATTTATTTATGTTGAGATGGAGTTTCACTCATAGTCTCCCAGGCTGGAGTGCAAGGGTGTGATCTCAGCTCACTGCA
ACCTCCGCCTCCCGCGTTCAACTGATTCTCCTGCCTCAGCCTCCAAAGTAGCTGGGATTACAGGCATGTGCCACCACGCC
TAGCTAATTTTTGTATGTTTAGTAGAGAGGGAGTTTCTCCATGATGGTCAGGCTGGTCTCCCGACCTCAGGTGATCCGCC
CACCTCCGCCTCCTGAAGTGCCGGAATTACAGGCGTGAGCCACCGGCCTAAAAGGCATTTTAATGGGATGAGATGAAAAC
TCATCGCGATTGTAATTTACATTTCTCTGATGATGAGTGATGCCGAGTACTTTTTCATATACGTGATCGCCATTTCTATG
TTTTGTTTGTGGAGAAATGTCTCCTCATGTCTTTTGCTCGTTTTTTAATTAAATTGTTTTATTGAGTTGTTTGAGCTTCT
TATATTTCCAGTTATTAATCCCGTCTCAGATGAATAGTTTGCAAATATTTGCTCCTATTTTGTCGGTTGTCTCTTCACTT
TCTTGGTTTATCTTTTGTGGTGCAGAAGTTGCTTGGTTTGATGTAATCCTAATGGTCTATTTTTTGCTTTGATTACTTGT
GTTTTGAAGGTTTTAAACAAAATGTCTTTCGTCAGACAAATGTCTTCCCCATTATTTTCTTCTACATGTTTCATAGGTTC
AGGCCTTAGACTCATGTTTTTAATCCATTTTCATTTGATTTTTGTGTATGGTGACAGGTATAGATGCAGTTTTATTCCTC
TGCATGTAGATATCCAGTTTTCCCCACACCATTTATTGAAAAGACTGTCCTTTCCTGATTGTAAGTTCTCGGCACCTTTG
TCAAAGTCCATTAAATGGGCTGGGTATGGTGGCTCACACCTGCAATTCCAGCACTTTGGGAGGCCGAGGCGGGTGGATCA
CCTGAAGCCAGGAGTTCAAGATCAGGCTGGCCAACAGAGTGAAACCTCGTCTCTACTAAAAATACAAAAATTAGCTGAGC
ATGGTGACCAGTGCCTGTAATACCACTACTCGGGTGTTTGAGGCAAGAGAATTGCTTGAATCCAGGAAGTGGAGGTTGCA
TTGAGCTGAGATTGCACCTCTGCACTCCAGCCTGCATGACAGAGCAAGATTCTAACACACACACACACAAAAAAAGCCAT
TGGATGTAAATGCATGGATTATATCTGTGTTCTCCATTCTGTTTCATTTTTTATGTGCCTTTCTTTATGCCAATGTCATG
CTGTTTTGCTTACTACAGCTCTGTAACATATTTCTAAGTCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTCAAG
TCTCAAGACAGTGGGCATCGCACACAAAAATTATGGAGAAGAGGATCCCAAGACTCCCAGGGTCCAACATTAGATAACAG
AGTGTTGGCCATGAACCAACCTCAAAGATTTCCATTGAGTAGAGGACAAGCACCCTCATTTCCTCACATCTCTCCTGTCC
CATGTTCTAGGAAACCCTTCAAGTAGTTGGCCTTCACCCACAGAACCAAGCTCCAAATCTGGTGAGTAAAGGACCCCTCT
TATCTCTGCTTTTGGAAACCTGGGGAGGTGGAAGCCTTGGATGCAAGTGTTGGCTCAAACCTCCCAGCTCTGTGAATGAG
GGCCTGTCTTCCACCATCTCTGAACTCCAGACACTCCAACAGTGAAAGGGATCTAGGGCCACCAAAGGGCTCAGCGAAGT
CTCTTAACCTTTAATGTCCTGCAGGTGAGACCTCCTACAAGCTAGAAGAATGATTGCCAATCTGACATCCTTCTCAGGAA
ACATGCAGTGTTTTTTCTTCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGACTTGAGAGAGGGAAGGGAAGGGAACA
TCTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCAAGGAATGAATTACTGTTGGTCATGAAGCAACCCTGGCTG
ACTCAGCAGAGCAAGAGCCTTGCCGTAACAGAGAACAGAGCTCATGCACGCACACTTCGACTCACTGACTCATTCAGCCA
CGGCCCCATGCTCAGGCTGTGCAGTTGGAATCCTTTCCTATTGTTGCCATAACAAATTTCCACAAGATTCGTGGGTGAAA
ACAAAACGGTTTTTTAATTATCTTACAGTGCTGTAGCTCAAAGTAGGAAGTGCATCTTACTGGGCTAAAATCAAGGTGAC
AGCAAGGCTGCCTTCCCTCTGAGGATTCCAGGCAAGAATCTGCTTCTCACTTGTCCCAGCTTCTAAAGGCTCCCAGTTCC
TTGGCTCCTGGTCCCCTTCCTCCTTCCTCAAAGCCCACAAAGACTGGTCACATCTCACATGGCATCACTCAGACCCTTCT
TCCTTACCACACCTCTTTCTCTGAATGCTGCTCTCCCTTCTTCCTTATCTTTTGAAAACTTGGGGATTCTATTGGGTTCA
CCAAGATGAAAATCCATCATAATCTCCCGGAAATCATTCAGGATACCCTTGTTTTAAGTTCAGCTGACTAGCAACCGTAA
TTCCATCTGCAATCTTCATTCCTTCTTTCCATGTAAAATAAGATATTCACAAGCTATGGAGGCTAGGACAGGGACATTTT
GGGGTGGGACAGCATTCTCCTGCCTTCCACGAACGGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGACACTGATATTG
CAGATGGTTAAATGGGAGGACAGAAAATGAATGCACAAGTGGACCAATAAATGAATGATCCATTGGGAAGCATCTGTGCA
TGAAATCTATTTGTTTGTTCGTTCATTTATTTATTGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAGTGCAGTGTCAC
GATCTTGGCTCACTGCAACCTGCGTCTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGCTGGGATTACAG
GCAACTGCCACCATGCCCGGCTAATTCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCACCATGTTGGCCAAGCTTGTC
TGAAACTCCCAACCTCAAGTGATCCGACCATCTCAGCAACCCAAAGTACTGGGATTACAGGCGTGAGCCACTTTGCCCAG
CCAGAATTCAAAATAAATAATAGATAATGCTGAGTGTATAATTTTGGGTGACAGAGAAGGTCTCACTAATCAGATATTTG
TGACATTAATGAAAAACACGGATTGAACCCCTGAAAGATTGGCGGAAGGATTTTCCACACACAGCTGTCAGCCGTGAAGG
CAGAAAGCTGAAAACAATCTGATGTGGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGAGAATGACAAGA
CGACTGTGGAGAGACGGAGAGCACACTGGGTACACAGGAAACTAAGGAGCAACAAGGAGTGTGTGTTTGACACTCACAGC
CATTGGATTCACCTCGGGGTAGCCAGGAATCCCTACATGATTAATAGTGACTGACATGAAAATAAGGGAGGCCCAGGTGC
GTAACTGGAATCTAGGAGACAGTGGAAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTAGACCCTAAGTG
GATGAAGCAGATGGATATAAGCTATGTTTGGGAGGTAGAATCATTTGCAGGGAGGGCTTGCTGGGTTTGAGTTTCCTAGT
TGTTTAATCCTTGCTAAATTAATTTCTTTCTGAGATTTATTCCTCCTACACATAAATCAATACCTGCCAAAGGAGTGACA
GATATATGAGGGGTGGTGGAAATGAAGGGACCTATTATAGCATAGTATACAAGTCTGTGAACGGTGGCTCACTCCTGTAA
CCCAGCACTGCAGGAGGCTAAGGCCAGTGGATTCCAAGAAGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGAGAAACC
CTATCTCTACATGGTGAAACCCTATCTCTCCTAAAAATACAAAAATTAGCCGAGCATGGTGGTGCATCCCTGTAATCCCA
GCTCCTGCTCTGGAGGATGAAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGTTGCAGTGAGTGGAGATCGCATCACT
GCACTCCAGCCTGGGTGACACAAGGAGACTCCATCTCAAAAAATAAAAATAAGAAATGCATAAATATAATAAAACACACA
CGAATGACAAAGGCACCTGAATTCCCATCATCATTTTTCTATTTCTCTATAATTACTTCTTTGATCCTTTATCTTATCCA
TTAGGCAATCAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGATCATATAGAAAATGTGAAAGCCCGCTG
AATCCTCCAGCACAAATCCTGGAATAGAGAAAGTGCTCTGGTCATCACAAAAAAAACTTGCCCCCTCACCCAAATCCCCC
ATCTCACCCCTACTTCCAATCACCTGTGGAGATACAGATAGATCATGGGGAGGTAAATGCTAATACTCCTTGGAGTGAGT
CCAGATCTTGGAATCAGAGATCAGTGCCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTCACAGGAGGACAGGTGGTA
TTGAAGCAATAGATAGTCGAGGGGGTGGTCCTTCCCCCAGCCTCTGAGGTAGAACAGCAGCCTAACATGTGTCTCCCGAG
ATCACAAAGAGTAGCACATTTCACACGGGCTTCAACACTATTTTCTGGCTGTTTGACATAAGAGAATTCTACTTCGCTTT
TTTTATATTGATTTCACTTTTGTTTCCTTTTCTTGGAGAATGCAAGTTGTTTAACTCAAGAATGCCGTGGATGTAGAAAT
CCTAAAGCACATTCGCTGTGTATCAATCCCAGTCCAGTCTTCCCAGAGAAGACTCTAAACACCTCCTGGACTGCACCTGG
GCCTATGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTTACATAGGCAGGTTCATT
ACTAACAGATAAGCAGCGAGTGACAACAGAAGCCTACATTTCAATGTGAGCCAGTTCCCCAAGGCTCAGAAAAGCTGCTC
GAGACATGTGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAG
CCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCCAGGCTGTTCTGGGA
CGATCCTCCTGATCTCAGGACTTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCT
AAAGAAGAGATTGGTTTGCCTCACCATTCTGCAGGCTGTACTGGAAGCATGGCACCAGCATCTATTTCTTATGATGGCCT
CAGGCCGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGATCACACGGCAAGAGAGGGAG
CAAGGGGGAGGGGGAGCAATGGAGCTTCCAAGCTCTTTTTAACAACCAGCTCTCCAGGAACTAATAGAGAGGGAACTTGC
TAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAACACCTCCCAAGAGGCCCA
ACCTCCCACACTGGGGGTTAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTAAAGTAGTTGTATCCTCAGC
ACGTTCCATGGTTACTATGAGAGCTATAACTGAGAAAGCAGGAGGAAGCTAGATCTCCCGCCATCTGGGTGCTTGTCCGA
AAGAGATGCTGTAAGTGGTTACCTGTCAATCAAGAAATGCAAGACAATTCATATAGAGAAACTGCTATGATTAGCTTCTT
ACTGGTGTCTCCTCTTCTTCCAGGTAACCCCAGACACCTGCACATTCTGATTGGGACCTCAGTGGTCATCATCCTCTTCA
TCCTCCTCCTCTTCTTTCTCCTTCATCTCTGGTGCTCCAACAAAAAAAGTAAGTCTCACGGGGCACAGGCCAGAGAGCTC
AGGGCCATGTGGGGAAGCAGGATGGGAGCACACAGCTGTGTTCCTCACTGGCAGGATGGTCCCTGGCCCAAGACAGGAGC
CACAGAGGCAGGACTTTCTAGAGAGAGCACCAGACTCCCTGCCCCTGCCTTCAGCTCACAGACCGTTGCCTGATTCTGAA
CTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGAGAGGCAGAAAGTGGGAGACAGAATCAAT
GGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGCAACT
GAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTCCGAG
CTCTTTTGTTGACTTCCGTCTCCTACAGATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGCCAACAGCGA
GGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAACGTGAGCACCCTCCCTCACTC
AGCATTTCCCTCCCTCACTCAGCATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTGAGGAGGTGACATACGCACA
GTTGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCTACAGATACCATCT
TGTACACGGAACTTCCAAATGCTAAGCCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGAC
GTCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGAGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGTG
AGTCTTCATCTTAGGGCATCGCTCCTCCTCACGCCACAAATCTGGTGCCTCTCTCTTGCTTACAAATGTCTAGGTCCCCA
CTGCCTGCTGGAAAGAAAACACACTCCTTTGCTTAGCCCACAGTTCTCCATTTCACTTGACCCCTGCCCACCTCTCCAAC
CTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAATTCCAAACATACAAGAGGCTCCC
TCTTGACGTGGCACTTACC

IPD-KIR