Allele Report for 2DS4*00101


2DS4*00101
Previous Designations & Local Names:
IPD Acc No:
Assigned: Sequence Last Modified:
Source Entries:  
Cells Sequence Derived From:  
Known Ethnic Origin Of Source: Unknown
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed:
Cells: 0 Laboratories:
Protein Sequence (0 aa)
Nucleotide Sequence Data (0 bps)
Genomic Sequence Data (95377 bps)
Nlib/2ds4genomiclib:2DS4_0010103ATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGGTTCTTCTTGCTG
CAGGGGGCCTGGCCACAGGAGGGAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGA
GACAGTCATCCTGCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTT
TGCACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCCTTGCAGGA
ACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATGGTGATCAT
AGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCCTGCA
GCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGC
ATCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCG
TGACGCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTGCTTGTTTCCGTCACAGGAAACCCTTCAAATAGTTGGCCTT
CACCCACTGAACCAAGCTCCAAAACCGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCT
TTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAATGCTGCTGTAATGGACCAAGAGCCTGC
AGGGAACAGAACAGTGAACAGCGAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAAYlib/2ds4geno
miclib:2DS4_0010104GTTTGGGAGGTTGGATCTAAGACATGTTTTGAGTTGGTCATAGTGAAGGACGCGAGGTGTC
AATTCTAGTGAGAGCAATTTCCAGGAAGCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAAAA
AGCCTGCGTACGTCACCCTCCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGTGCT
GCTGAGCTGAGCTGGGGCGCGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCATCATCATGGCGTGTGTTG
GTGAGTCCTGGAAGGGAATAGAGGGAGGGAGCGTGGGGATGGAGATCTGGGCCCAGAGGTGGAGATATGGGCCTGGAGGT
GGAGTTATGGGCCTGGAGTGGAGATCTGGGCCTAGAGATGGAGTGATGAGCCTAGAAGTGGAGATCTGCGCCTGGAGTGG
AGATCTGGGCCTGGAGTGAAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGGGATAGGAACCTGGAGTGGAGAG
AGGAACCTGGAGGAGAGATAGGAACCTGGAGGGGAGGTAGGAGCCTAGGGTGGAGATATGGGACTGGAGTGGAGATATGG
GACTGGAGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATACGGGCC
TGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGTCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCA
GTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTAGAGTG
GAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAG
ATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTA
TGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGGAGATAGGG
GCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCC
TGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGG
AGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGGAGATACGGGCCTGGAGG
TGGAGATCTGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGA
GATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATA
TGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGACATATGGGTCTGGAGTGGAGATACGGGCCTGGAGGTGGAGATATGG
GCCTGGAGTGGAGATATGGGCCTGGAGGTGGTGATATGGGCCTGGAGTGTAGACATGGGCCGAGTGGAGATATGGGTCTG
GAGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTGGAGTGGAGATATAGGCATGGGGTGGAGACATGGGCCGGGAGT
GGAGATATGGGACTGGAGTGGAGATACGGGCGTGGGGTGGAGATATGTGCCTGGAGGTGGAGATATGGGCGTGGGTTGGA
GATATGGGCCTGGAGTGGAGATATGGGCGTGGGGTGGAGATATGGGTCTGGAGTGGAGACATGGGCATGGGGTGGAGATA
TGGGCCTGGTGTGTAGATATGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATCTGGG
CCTACGGTGGAGATATGGGCCTAGGATGGGGATATGGGCCTGGAATGGAGATATGGGCCTGGGTGTGGAGATATGGGACT
GGAGTGGAGATATGGGCCTGATGTGGAGATATGGGCTTGGAGTGGAGATATGATCCTGGAGTGTAGTTATGGGCCTGGAG
GTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTGGAGAGGAGATATGGGACTGGAGTGG
AGATATGGGCCTGGAGTGGAGATATGGGCCTGGATTGGAGATATGGGCCGAGGGTGGAGATCTGAGCCTGGATTGGAGAT
GTGGGCCCGGATTGGCTATATGGGTCTAGGGTGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGG
GCTTGGGGTCGGGATATGGGCCTGGAGGCTGGGTCTCTGTACAGCCGAGAGCACTGTTCTTGGGTGCAGGTAGGCACTGA
TGGTGAGTTTACCTTCGGCCCAGGAAGGGGCTGGCTATCAAGACTCACAGCCCAGTGGGGGCAGCAAGGAAGGCCTTGTT
TGCCTGCAAATGGATCTTCCATCATGATCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGGGTAA
GTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGAAACGGGAGGGAAGTCCTGTCAGGGAGT
CTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCCACAGTTCCGACCTTGCCTCCCTGGCCTCTCAACCCCTT
GGCAGAGTCAAGTTGTGTGGGGACCAGGGTTGGACTAGGGTGTTCAAAGCTGGGTTGTGTGGTGGGGAAGTGGTAGGAAC
AGCAGATCCTCTGAGGACAAAGGTGTTACTCACACACTTCAGCGTTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGT
CATTCTACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACATTCCAAATCCTCTGATGGGGGCTAAGTTTTTTATTT
TCATTCAGGCAACTGCTGATATTCCATTCTCAAAGGACATGCCCTCCACTTCATGTCTACCCTGTGTTGTTTTATGTCAG
TAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAC
GGAGACACCTTGTCTTTGTGGGATGGGTCCTTCCTTTAGCCCTAGGCACCAAGGTGTGATAGCAGCCATAGAAATGTGGA
AAGTGGGGAGAATCTTCTGAGCACAGGGAGGGAGGCACAGCTCCACATCCTCCTCTCTAAGGCGGCGCCTCCTTCACCCC
AAGGTGGTCAGGACAAGCCCTTGCTTTCTACCTGGCCCAGCCTTGTGGTGCCTCCAGAACATGTGACTCTTCAGTGTCAC
TCTAATCTTGGGTTTAACAACTTCAGTCTGTACAAGGATGATGGGGTGCCTGTCCCTGAGCTGTACAACAGAATATTCTG
GAAAAGCCTTTTCATGGGCCCTGTGACCCCGTCACATGCAGGGACCTATAGATGCCGGGGTTCACACACACACTCCCCCA
GTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCC
ACCTCCTGAATCCCAGAGCTTCTGGTAGGCATGTCCTTGAGGGTCCCATCATGCAGGCCCTAACTGTATTTGGGGTAAAG
GGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAAGTGTCCCCAGTGATGACTGCATTCTAATCCCTGGAG
TCTGTGACTATTTATGTTATAGGGGAAGGGACTGAAGGGGAAGATGGAGCTCAGGTTGTTGATGAGTTGACCTTGAGATG
GGGAGACAGCCTGGACTGTCCCGGTGGGCTCAATATAATCACAAGTGTCCACATGAAAGGAGGAGGAAGAGGAGAGTGGG
GATTAGAGCAGCGTAGTGGGAGACTCCATTAGCTTTGAAGGTGGATGAAGGCCATAAGCCATGAATGCAGGTGGCCTATA
GAGGCTGGGAAAGTCAAGTAACTGATTCTCCTGAGTCTCCAGAGGGAACACAGCCCTGCAGATGCCTTGATTTTAGCCCT
CGAAAAACAGGGTCCGCTTTCTGTCTCCAGAATCGGAGGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATT
TTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGACAAGTTAAGAAAAGACACAAGGATAGCCAGGCAT
GGTGGCAGGTGCATGTAATCCTAGCGACTCGGGAGGCTGAGAGCAGGAGAATCGCTTGAACCCAGGAGACAGAGGTTGCA
GTGAGCGTAGACCACACCACTTCACTCCAGCCTGGGTGAAGGAGTGAGACTCTGTCTCCAAAATTAATTAATTAATTAAA
GAAACCAAACAAAGAGAAGGTTGGCTACACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACA
TAGGGAGGGGTTGATACTCCTCAAATCAGCACGAGGAGCCAGCCTATGGAAACTGGCACCATGGAGAAGGCACAGACATG
GCAAGAGTGGCTCCCAGTCCCCACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTCCT
GCCAAGGATTCCAATTCGTCCAAAAGAGATTGAACCAGGCTGCTAAGAGCCGGGACGTGCAGCCTATCCTGCTTCCTCTT
CCACTCCCACATAGACAGTAAGAAAGACATTAGTGTGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGTGGG
AAGGGAATCACAGCTACTAGAGACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGCACCAGGAGTTATG
GGCACAGAAAAGAACATGAAGACACAGAGAGGAAGCAGAGAGACAGACACCAGCGAAGGGAAGTCTCACTCATTCCAGGT
GCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCTTC
CTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCGGATGTCATGTTTGAGCACTT
CCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTTGCACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACT
TCTCCATTGGTCCCATGATGCCTGTCCTTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTG
TCAGCTCCCAGTGACCCTCTGGACATGGTGATCATAGGTGAGAGTGTCCAGACATTCTTCTCATTGTCATTGGGATGCAG
AGTGAATGATCCAGGACTTGGAGACCCAGGTGGTTGTAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTGACTTG
GTGAGGTCTGTGCCAACAGAGACAGAGAAACAAGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAAACACAGGG
GCCATACCGGGAGTTAGAAAAGACAGAAAGAGTTAAAGGAGACAGACAGACATGTCCCAGACAGAGGTGTCCTTCCATGC
TGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAAC
CCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGGCCTCAGGCCTTGTGGCACCTACAGATGCCATGCTTATTC
TGACACCTCTGACTTCCATGCAATGGAGAATAATCGTCCCAAAATATCATGGCCCCAGAACACCAACCCCTGTATGCTGT
GTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATCACATATGAGAGGATCACTGA
GAAGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACACACAGAGAAAGAGCCAGAGGAAGGAGATTGAGA
GACTCACAGACACATAAAGAGAGAGAAGAGGGCAGAGAAGTGGAGAGAATGATGGAAGAGAGCAGAGAAAACCACTAAAA
TTAGAGTCCTGAGGGCGAGGCACAAGGGCATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTA
GAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATACAGATAGATGATGGATAGATATAGATAGATGATAT
ATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGATTGATTGATTCATTAATAGATGATACATAGAGATGA
TGATGATGAAGATAGATGGATAGATAATACATAGAGATAGAGAGGAAGACAAAGAGAGAAATAATAGAGAGAGAGAGATG
ATACATATATATAGATAATAGATGATTGACGGATAGACAATTGATAGATAAATAGATGATATATAGATATAGATGACAGG
TAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATGGATTGATAGATAATAGATAGAAATATGCAGAAAGTTATGA
ACGGGACACAAACTGAGAAACTCAGAGTTAAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGCCAGAGAGAATAAA
ACAATCCAAAAAAGGAAAACATAACTAGAGGTAGGGAAGTGAGGTCAGAGACCTACAGAGACAGAGAAGGTGGAAGGAGG
AAATAGACATGAAGAGAGATAGGGTGGAGGGTGAGACAGAGAAAGAGAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCT
CAGGTCAGGTGTGAGGGGAGCTGTGACAAGGAAGATCCCCCCTGAGGAAACTGCCCCTTCTCCTTCCAGGTCTATATGAG
AAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTC
CTATGACATGTACCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCAACGGAACAT
TCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTAC
GAGTGGTCAAACTCGAGTGATCCACTGCTTGTTTCCGTCACAGGTGAGGAAACCCCATATCTGTCCCATGTCCTATGATC
CTAGAGCCTTAGCTGAGGAGCTTCCTGCTGATGATGGAGAGAAGCATGGACAGATGCAGAGAGAAGACGCAGCATGCCTG
TGAGGGAGGGATCAGGGCGCAGGATGGCACACACAGCACCTCCAAACCCTCCTGCATGGCCTGCATGGAGGCCTCCGATT
AGGGCTCCAGAAACCCAGGCAGATGTAGAAAGCGGTCAGGAGAGACCCAGAGAAGGGGAGACTGGGCTCAGTTTGGGGAG
ATCAGAGGTTCCCTCAGCCCCTCAACCTTACCCATTTCCCAGAAGCCCTTCCTGGCCTCTCACCCACACAGAGATGTCAT
CACCAGCAACCCCTACATCCTTTTCTTTTTGTTTGAAAAAATATTCATTGAGGTTAAATATACCTATATAGCTTACCACT
TTTAACATTTTTTTTTTTTTGAGGTGGAGTCTAGCTCTGTCTCCTATGCTGGAATGCAGTGGCACAATCTCAGCTCACTG
TAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCACCTGAGTAGCTGGTACTACAGGCGCCCATCACCACG
CCGGGCTACTTTTTGTATATTTAGTAGAGAGGGGGTTTCACCATGTTGGTCGAGCTGCTCTGGAACTCCTGACCACGTGA
TCCACCCGCCTCAGGCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCCACGTTTACCAATTTTAAGTG
TAAGGTCTAGTGGTCATAAATACATACATATAAATTTTTTGTTTGTTTGTTTTATCCTCCACCCTTTTCTTCCTGGCCTC
TGGTAGCCACCATTCTACTCTCTATCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTGAGAAATGAGAATATTTG
TAATGACTTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTATTCTTTCTATGGATGAGTAGTCTCCGCTGTGCG
TATGTACTACATTCTCTCTATCCATTCATCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTGAAGAGTG
CTGCACCAATCATACGAGTGCAGATATCACTTCGATACATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGAAATT
GCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTGTGCC
CAGGCTGGAGTACAAGTGATGTGATCTTGGCTCATTGCAACCTCCGCCTCCTGGGTTCAAATGATTTTCCTGCCTCAGCC
TCCCTAGTAGCTGGGATTACAGGTGCACGCCACCATGCCGGGATACTTTTTGGTTTTTTTTAGTGTACATGGGGTTTCCC
CAGGTTGGCTAGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTACAGG
CATGATCCACTTCATCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCATACTTTTCTCCGTAATGGCTGTACTAATTTAC
ACTCCTACCAACAGGGTACCAGGGTTCTCCTTTCTCTACCACCTTGCCAGCATTTGTTTTGCCTGTCTTGCAGCTAAAAG
CCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCG
GCTCACCGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACACA
CCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGCGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCCCGA
CCTTATGAGATTCGCCCACCTCGGGCTCTCAGAGTTCTAGGATGACAGACGTGAGCCACCTCGCCCGGCCTAAAAGCCAT
TTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTCGCGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTCGT
ATGTGGGGAAATTTCATGTCTTTTGCTCCTTTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATACTT
CTAGTTATTAATCCCGTCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTGGT
TTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTGAA
GGTTTAAAACAAAATGTCTTCCTTCAGACAAATGTACTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCACAGGTT
CAGGCCTTAGACTCACATCTTTAATCCACTTTCATTTGATTTTTGTGTATGGTGACAGGTAGAGGTGCAGTTTCATTCCT
CTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAAACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCTTT
GTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTAACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGCTGGTGGATC
ACCTGAGGACAGGAGTACAAGATTACTCTGGCCGACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTGAG
CATGGTGGTCAGCACCTGTAATACTACTACTCAGGAGTTTGAGGCAAGAGAATTGAATGAACCCAGGAGGCTGAGGTTGC
AGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTCAAAAGAAAAAATAAAAAAAAT
TGGATGTAAATGCATGGATTATATCTGTGTTCTTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACATCAT
GCTGTTTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTGAA
GTCTCAAGACAGTGGGCGTCACATACAAAAATTATGGAAGAAAGGATCCCTGGACTCCCAGGGCCCAATGTTAGATAACA
GAGTGTTGGCCATGAACCAAACTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCTGTC
TCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGGACCCTCT
TATATCCGCTTTTGGAACCCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACATTGT
ACGCCTGTCTTCTACCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGGCCCAACACAGGGCTCAGTGAAA
TCTCTTCATCTCTCATTTTATGGAGCTGAGACCTCCTACAAGCTAGAAGAATGATTGCCAATCTGACATCCTTCTCAGGA
AAAACGCAATGTTTGTTCTGCTTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGAAGCGAAC
ATCTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCAAGGAATGAGCTCCTGTTGGTCATGAAACAACCCTGGCT
GACTCAGCAGAGCAAGAGCCTTGCCGTAACAGAGAACAGAGCTCATGCACGCACACTTTGACTCACTGACTTATTCAGCC
ACGGCCCCATGCTCAGGTTGTGCAGTGTGGAAGCTTTTCCTATTGTTGCCATAACAAATTTCCACAAGATTCGTGGGTGA
AAACAAAACGGTTATTTAATTATCTTACAGTGCTCTAGCTCAAAGCATGAAGTGCATCTCACTGGGCTAAAATCAAGATG
ACAGCAAGCCTGCCTTCCCTCTGAGGATTCCAGGCAAGAATCTGCTTCTCACTTGTCCCATCTTATAAAGGCTCCCAGTT
CCTTGGCTGCTGGTCCCTTTCCTCCTTCCTCAAAACCCACAAAGACTGGTCACATCTCACATGGCATCACTCAGACCCTT
CTTCCTTACCACACCTCTTTCTCTGAATGCTGCTCTCCCTTCTTCCTCATCTTTTGAAAACTTGGGGATTCTATTGGGTT
CACCAAGATGAAAATCCGTCATAATCTCCCGGAAATCATTCAGGATACCCTTGTTTTAAGTTCAGCTGATTAGCAACCAT
AATTCCATCTGCAATCTTCATTCCTCCTTTCCATGTAAAATAACATATTCACAAGCTATGGAGGCTAGGACAGGGACATT
TTGGGGTGGGACAGCATTCTCCTGCCTTCCACAAATGGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGACACTGATAT
TGCAGATGGTTAAATGGGAGGACAGAAAATGAATGCACAAGTGGACCAATAAATGAATGATCCATTGGGAAGCATCTGTG
CATGAAATCTATTTGTTTGTTTGTTCGTTTGTTTATTGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAGTGCAGTGTC
ACGATCTTGGCTCACTGCAACCTGCGTCTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGCTGGGATTAC
AGGCAACTGCCACCATGCCCGGCTAATTCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCACCATGTTGGCCAAGCTTG
TCTGAAACTCCCAACCTCAAGTGATCCGACCATCTCAGCAACCCAAAGTACTGGGATTACAGGCGTGAGCCACTTTGCCC
AGCCAGAATTCAAAATAAATAATAGATAATGCTGAGTGTATAATTTTGGGTGACAGAGAAGGTCTCACTAATCAGATATT
TGTGACATTAATGAAAAACACGGATTGAACCCCTGAAAGATTGGCGGAAGGATTTTCCACACACAGCTGTCAGCTGTGAA
GGCACAAAGGTGAAAACAATCTGATGTTGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGAGAATGACAA
GATGACTGTAGAGAGATGGAGAGCACTCTGGGTACACAGGAAACTAAGGAGGAACAAGGAGTGTGTGTTTGACACTCACA
GCCATTGGATTCACCTCGGGGTAACCAGGAATCCCTACATGATTAATAGTGACTGACAAGAAAATAAGGGAGGCCCAGGT
GCGTAACTGGAATCTAGGAGACTGTGGAAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTAGACACTAAA
TGAATGAAGTAGATGGATATAAGATATGCTTGTGAGGTAGAATCATTGGCTGGAAAGGCTTGCTGGGTTTGATTTTCCTA
CTTGTTTAATCCTCGCTTAATTAATTTCTTTCTGAGATTTATTCATCCTACACATAAATCAATACCTGGCAAAGGAGTGA
CAGATATATGAGGGGTGGTGGAAATGAAGGGACCTATTATAGCATAATATACAAGTCTGTGAACGGTGGCTCATGCTTGT
AACCCAGCCCTGCAGGAGGCCAAGGCGGGTGGATTCCATGAAGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAAA
CCCTATCTGTACTAAAAATACAAAAATTAGCCGAGCATGGTGGTGCATCCCTGTAATCCCAGCTCCTACTCTGGAGGATG
AAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGTTGCAGTGAGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGAC
ACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAAATATAATAAAACACACACGAATGACAAAGGCACCTG
AATTCCAATCATCATTTTTCTATTTCTCTATAATTACTTCTTTGATCCTTTATCTTATCCATTAGGCAATCAGCCTAAAA
CCTCTTCCCTATTTGGCTTTCTGTGAGCATGAGATCACATAGAAAATGTGAAAGCCCGCTGAATCCTCCAGCACGGATCC
TGGAATAGAGAAAGTGCTCTGGTCATCGCAAAAAAAAACTTGCCCACTCACCCAAATCGCCCACCTCACCCCTACTTCCA
ATCACCTGTGGAGATTCAGATAGACCATGGGGAGGAAACATTAATATTCCTTGGAGTGAGTCCAGATCTTGGAATCAGAG
ATCAGCGACAGCACTAGCTCCTGTTCCCCTTTCCTACTAATTCACAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGG
AGGGGGTGGTCCTTCCCCCAGCCTCTCGGGTAGAACAGCAGCCTAACATGTGTCTCCCGAGATCACAAAGAGCAGCACAT
TTCACACGGGCTTCAACACTATTTTCTGGCTGTTTGACATAAGAGAATCTTGCTTCGCTATTTTTAATCGTGATTTCACC
TTTGTTTCCTTTCCTTGGTGAATGCAATTTGTTTGACTCAAGAATGCTGTGGATGTAGAAATCCTAAAGCACATTCGCTG
TGTATCAATCCCAGTGCAGTCTTCCCAGAGAAGACTCTAAACAAATCCTGGACTGCACCTGGGCCTATGCCAATTCCTAT
CACTCACCGTCACTCCAGGGAGACAGAACACACAGAGGATACGTTACATAGGCAGGTTCATTACTAACAGATAAGCAGCG
AGTGACAACAGAAGCCTGCATTTCAATGTGAGCCAGTCCCTCAAGGCTCAGAAAAGCTGCTCGGGACATATGGAGTCACC
CCATTTGCAGTGTAACTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGC
TAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCCAGGCTGTTCTGAGACATTCCTCCTGATCTCAG
GATGTTGCTATCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCTAAAGAAAAGAGATTGGTT
TGCCTCACAGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGAATCTATTTCTCTTGACGGCCTCAGGCTGCTCCCACTC
TGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCGCAGAGATCACACGGCAAGAGAGAGAGTAAGGGGGAGAGGGAG
CGATGGAGCTTCCAAGCTCTTTTTAACAACCAGCTCTCCAGGAACTAACAGAGGGGGAACTTGCTAACCCCGTCTCCTTG
GGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAACACCTCTGAAGAGGCCCAACCTCCCACAATGGGG
GTGAAATTTCAATGTGAGGTTTGAAAGGGTCAAACATCTCAACTAAAGTAGTTGTATCCTCAGCACGTTCTATGGTTACT
ATGAGAGCTATAATTGAGAAAGCAGGGGAAAGCTAGGTCTCCCGCCATTTGGGTGCTTGTCCTAAAGAGACGTTGTATGT
GGTTACCTGCCAATCAAGAAATGCGAGACAATTCATAAAGAGGAACTGCTATGATTAGCTTCTTATTGGTGTCTCCTCTT
CTTCCAGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTT
TCTCCTTCATCGCTGGTGCTCCGACAAAAAAAGTAAGTCTCACGAAGCAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAA
GCAGGATGGGAGCACGCGGATGTGTGTTCCTCACCAGCAGGATGGTCCCTGGCCCAAGACAGGAGCCACAGAGGCAGGAC
TTTCTAGAGAGAGCACCAGATTCCCTTCCCCTGCCTTCAGCTCACAGACCATTGCCTGATTCTGAACTGTATCCTCACGT
CCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGAAAGTGGGAGATAGAATCAATGGGATGGGAACTCA
GAGCTATTCATGGGATGGGTCCTTGAACTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGC
ACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACT
TCCGTCTTCTACAGATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGTAGGTGCTCCTC
GGCCCAGCCTCGTGGCTAGTCTTATTCCCAAAGAGTCCTGAAAAATGTGAGCACCCTCCCTCACTCAGCATTTCCCTCTC
TCCAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAATTGGATCACTGTGTTTTCACACAGAGAAAAATC
ACTCGCCCTTCTGAGAGGCCCAAGACACCCCCAACAGATACCAGCATGTACATAGAACTTCCAAATGCTGAGCCCAGATC
CAAAGTTGTCTTCTGTCCACGAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAAAC
CGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCTTCCTCACAC
CACGAATCTGAACATGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTCCTTT
GCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACCTGAG
GCTGCAATCACACTGAGGAACTCACAATTCCAAACATACAAGAGGCTGCCTCTTAACACAGCACTTAGACACGTGCTGTT
CCACCTCCCTTCAGACTATCTTTCAGCCTTCTGCCAGCAGTAAAACTTATAAATTTTTTAAATAATTTCAATGTAGTTTT
CCCGCCTTCAAATAAACATGTCTGCCCTCATNlib/2ds4genomiclib:2DS4_0010105GTTTGGGAGGTTGGATC
TAAGACATGTTTTGAGTTGGTCATAGTGAAGGACGCGAGGTGTCAATTCTAGTGAGAGCAATTTCCAGGAAGCCATGTTC
CGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAAAAAGCCTGCGTACGTCACCCTCCCATGATGTGGTCAAC
ATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGTGCTGCTGAGCTGAGCTGGGGCGCGGCCGCCTGTCTGCAC
CGGCAGCACCATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAATAGAGGGAGGGAGCGTGG
GGATGGAGATCTGGGCCCAGAGGTGGAGATATGGGCCTGGAGGTGGAGTTATGGGCCTGGAGTGGAGATCTGGGCCTAGA
GATGGAGTGATGAGCCTAGAAGTGGAGATCTGCGCCTGGAGTGGAGATCTGGGCCTGGAGTGAAGATCTGGGCCTGGAGT
GGAGATATGGGCCTGGAGTGGGGATAGGAACCTGGAGTGGAGAGAGGAACCTGGAGGAGAGATAGGAACCTGGAGGGGAG
GTAGGAGCCTAGGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGTTAT
GGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATACGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGT
CCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTG
GAGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGA
GTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGG
AGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAG
ATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATA
TGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGG
CCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGCC
TGGAGTGGAGATATGGGACTAGAGTGGAGATACGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATATGGCCCTGG
AGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTG
GAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGACA
TATGGGTCTGGAGTGGAGATACGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGTGATA
TGGGCCTGGAGTGTAGACATGGGCCGAGTGGAGATATGGGTCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGAC
TGGAGTGGAGATATAGGCATGGGGTGGAGACATGGGCCGGGAGTGGAGATATGGGACTGGAGTGGAGATACGGGCGTGGG
GTGGAGATATGTGCCTGGAGGTGGAGATATGGGCGTGGGTTGGAGATATGGGCCTGGAGTGGAGATATGGGCGTGGGGTG
GAGATATGGGTCTGGAGTGGAGACATGGGCATGGGGTGGAGATATGGGCCTGGTGTGTAGATATGGGCCTGGAGTGGAGA
TATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATCTGGGCCTACGGTGGAGATATGGGCCTAGGATGGGGATATG
GGCCTGGAATGGAGATATGGGCCTGGGTGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGATGTGGAGATATGGGC
TTGGAGTGGAGATATGATCCTGGAGTGTAGTTATGGGCCTGGAGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTG
GAGTGGAGATATGGGACTGGAGAGGAGATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGATT
GGAGATATGGGCCGAGGGTGGAGATCTGAGCCTGGATTGGAGATGTGGGCCCGGATTGGCTATATGGGTCTAGGGTGGAA
ATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCTTGGGGTCGGGATATGGGCCTGGAGGCTGGGTCT
CTGTACAGCCGAGAGCACTGTTCTTGGGTGCAGGTAGGCACTGATGGTGAGTTTACCTTCGGCCCAGGAAGGGGCTGGCT
ATCAAGACTCACAGCCCAGTGGGGGCAGCAAGGAAGGCCTTGTTTGCCTGCAAATGGATCTTCCATCATGATCTTTCTTT
CCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGGGTAAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACA
TAAGAGGATTTTCCTGAAACGGGAGGGAAGTCCTGTCAGGGAGTCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCT
CGGCCCACAGTTCCGACCTTGCCTCCCTGGCCTCTCAACCCCTTGGCAGAGTCAAGTTGTGTGGGGACCAGGGTTGGACT
AGGGTGTTCAAAGCTGGGTTGTGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACA
CTTCAGCGTTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCATTCTACCAGAAGAGGTGGGAAACCACAGCCATGG
CCCTGACATTCCAAATCCTCTGATGGGGGCTAAGTTTTTTATTTTCATTCAGGCAACTGCTGATATTCCATTCTCAAAGG
ACATGCCCTCCACTTCATGTCTACCCTGTGTTGTTTTATGTCAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTT
ACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTACGGAGACACCTTGTCTTTGTGGGATGGGTCCTTCCTT
TAGCCCTAGGCACCAAGGTGTGATAGCAGCCATAGAAATGTGGAAAGTGGGGAGAATCTTCTGAGCACAGGGAGGGAGGC
ACAGCTCCACATCCTCCTCTCTAAGGCGGCGCCTCCTTCACCCCAAGGTGGTCAGGACAAGCCCTTGCTTTCTACCTGGC
CCAGCCTTGTGGTGCCTCCAGAACATGTGACTCTTCAGTGTCACTCTAATCTTGGGTTTAACAACTTCAGTCTGTACAAG
GATGATGGGGTGCCTGTCCCTGAGCTGTACAACAGAATATTCTGGAAAAGCCTTTTCATGGGCCCTGTGACCCCGTCACA
TGCAGGGACCTATAGATGCCGGGGTTCACACACACACTCCCCCAGTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCA
TGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAATCCCAGAGCTTCTGGTAGGCATGTCC
TTGAGGGTCCCATCATGCAGGCCCTAACTGTATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGG
AAGAATAAGTGTCCCCAGTGATGACTGCATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGGACTGAA
GGGGAAGATGGAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGGTGGGCTCAATAT
AATCACAAGTGTCCACATGAAAGGAGGAGGAAGAGGAGAGTGGGGATTAGAGCAGCGTAGTGGGAGACTCCATTAGCTTT
GAAGGTGGATGAAGGCCATAAGCCATGAATGCAGGTGGCCTATAGAGGCTGGGAAAGTCAAGTAACTGATTCTCCTGAGT
CTCCAGAGGGAACACAGCCCTGCAGATGCCTTGATTTTAGCCCTCGAAAAACAGGGTCCGCTTTCTGTCTCCAGAATCGG
AGGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCC
AGGTCAAGGACAAGTTAAGAAAAGACACAAGGATAGCCAGGCATGGTGGCAGGTGCATGTAATCCTAGCGACTCGGGAGG
CTGAGAGCAGGAGAATCGCTTGAACCCAGGAGACAGAGGTTGCAGTGAGCGTAGACCACACCACTTCACTCCAGCCTGGG
TGAAGGAGTGAGACTCTGTCTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTACACCGAGAT
CAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCAACATAGGGAGGGGTTGATACTCCTCAAATCAGCACGAGG
AGCCAGCCTATGGAAACTGGCACCATGGAGAAGGCACAGACATGGCAAGAGTGGCTCCCAGTCCCCACCAGGAACAGGGT
GTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTCCTGCCAAGGATTCCAATTCGTCCAAAAGAGATTGAACC
AGGCTGCTAAGAGCCGGGACGTGCAGCCTATCCTGCTTCCTCTTCCACTCCCACATAGACAGTAAGAAAGACATTAGTGT
GAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGTGGGAAGGGAATCACAGCTACTAGAGACAGAGGGACAGAG
AAGAGGGAGGGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGC
AGAGAGACAGACACCAGCGAAGGGAAGTCTCACTCATTCCAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAA
ACTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAG
ACAGTCATCCTGCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTT
GCACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCCTTGCAGGAA
CCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATGGTGATCATA
GGTGAGAGTGTCCAGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCAGGACTTGGAGACCCAGGTGGTTG
TAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTGCCAACAGAGACAGAGAAACAAGAG
ACACAAGTACAGACCAGGTGTCATAACAGAGGACAAACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAAGAGTTAA
AGGAGACAGACAGACATGTCCCAGACAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTT
TCATTTCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCC
TGTGGCCTCAGGCCTTGTGGCACCTACAGATGCCATGCTTATTCTGACACCTCTGACTTCCATGCAATGGAGAATAATCG
TCCCAAAATATCATGGCCCCAGAACACCAACCCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTC
ACATTCCAAATAACCCCACATATCACATATGAGAGGATCACTGAGAAGCACAGAGAGAAATCAGGGACACCAAAAAGCAA
AGACATAAACACACAGAGAAAGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAGAGGGCAGA
GAAGTGGAGAGAATGATGGAAGAGAGCAGAGAAAACCACTAAAATTAGAGTCCTGAGGGCGAGGCACAAGGGCATAGAAA
GATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGAT
GGATAGATACAGATAGATGATGGATAGATATAGATAGATGATATATAGGTAGATGATAGATAATAGGTTATAGATACATA
GATGATGATTGATTGATTCATTAATAGATGATACATAGAGATGATGATGATGAAGATAGATGGATAGATAATACATAGAG
ATAGAGAGGAAGACAAAGAGAGAAATAATAGAGAGAGAGAGATGATACATATATATAGATAATAGATGATTGACGGATAG
ACAATTGATAGATAAATAGATGATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATA
GATGGATTGATAGATAATAGATAGAAATATGCAGAAAGTTATGAACGGGACACAAACTGAGAAACTCAGAGTTAAAAAAA
GTAACATCAAGTCAACCAATCCAAGGAGAGCCAGAGAGAATAAAACAATCCAAAAAAGGAAAACATAACTAGAGGTAGGG
AAGTGAGGTCAGAGACCTACAGAGACAGAGAAGGTGGAAGGAGGAAATAGACATGAAGAGAGATAGGGTGGAGGGTGAGA
CAGAGAAAGAGAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCTCAGGTCAGGTGTGAGGGGAGCTGTGACAAGGAAGAT
CCCCCCTGAGGAAACTGCCCCTTCTCCTTCCAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTT
CAGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAGGGGAGGC
CCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACG
GAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTGCTTGTTTCC
GTCACAGGTGAGGAAACCCCATATCTGTCCCATGTCCTATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGATGATG
GAGAGAAGCATGGACAGATGCAGAGAGAAGACGCAGCATGCCTGTGAGGGAGGGATCAGGGCGCAGGATGGCACACACAG
CACCTCCAAACCCTCCTGCATGGCCTGCATGGAGGCCTCCGATTAGGGCTCCAGAAACCCAGGCAGATGTAGAAAGCGGT
CAGGAGAGACCCAGAGAAGGGGAGACTGGGCTCAGTTTGGGGAGATCAGAGGTTCCCTCAGCCCCTCAACCTTACCCATT
TCCCAGAAGCCCTTCCTGGCCTCTCACCCACACAGAGATGTCATCACCAGCAACCCCTACATCCTTTTCTTTTTGTTTGA
AAAAATATTCATTGAGGTTAAATATACCTATATAGCTTACCACTTTTAACATTTTTTTTTTTTTGAGGTGGAGTCTAGCT
CTGTCTCCTATGCTGGAATGCAGTGGCACAATCTCAGCTCACTGTAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGC
CTCAGCCACCTGAGTAGCTGGTACTACAGGCGCCCATCACCACGCCGGGCTACTTTTTGTATATTTAGTAGAGAGGGGGT
TTCACCATGTTGGTCGAGCTGCTCTGGAACTCCTGACCACGTGATCCACCCGCCTCAGGCTCCCAAAGTGCTGGGATTAC
AGGCATGAGCCACCGCGCCCGGCCACGTTTACCAATTTTAAGTGTAAGGTCTAGTGGTCATAAATACATACATATAAATT
TTTTGTTTGTTTGTTTTATCCTCCACCCTTTTCTTCCTGGCCTCTGGTAGCCACCATTCTACTCTCTATCTTCATGAGAT
CCACCTTTTAGCTCCTGTATATGGGTGAGAAATGAGAATATTTGTAATGACTTCCAGTTCCATCCATGTGGCTGCAAATA
TCAGGATGTTATTCTTTCTATGGATGAGTAGTCTCCGCTGTGCGTATGTACTACATTCTCTCTATCCATTCATCCACTGA
TGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTGAAGAGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGAT
ACATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGAAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCG
TTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTGTGCCCAGGCTGGAGTACAAGTGATGTGATCTTGGCTCATT
GCAACCTCCGCCTCCTGGGTTCAAATGATTTTCCTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGTGCACGCCACCAT
GCCGGGATACTTTTTGGTTTTTTTTAGTGTACATGGGGTTTCCCCAGGTTGGCTAGGCTGCTCTCAAACTCATGACCTCA
ACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTACAGGCATGATCCACTTCATCCAACCTCTTTTTAGTTCTTT
AAAGGACTTCCATACTTTTCTCCGTAATGGCTGTACTAATTTACACTCCTACCAACAGGGTACCAGGGTTCTCCTTTCTC
TACCACCTTGCCAGCATTTGTTTTGCCTGTCTTGCAGCTAAAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAG
TTTCGCTCTTGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACCGCAACCTCCACCTCCCAGGTTCAAGCGAT
TCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACACACCACCACGCCCGACTAATTTTTGTATTTTTAGTAGA
GACAGCGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCCCGACCTTATGAGATTCGCCCACCTCGGGCTCTCAGAGTT
CTAGGATGACAGACGTGAGCCACCTCGCCCGGCCTAAAAGCCATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTA
ATTCGCGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTCGTATGTGGGGAAATTTCATGTCTTTTGCTCCTTTTTCA
ATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATACTTCTAGTTATTAATCCCGTCTCAGATGCATAGTTTGCA
CATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTGGTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGG
TAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTGAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAATGTA
CTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCACAGGTTCAGGCCTTAGACTCACATCTTTAATCCACTTTCATT
TGATTTTTGTGTATGGTGACAGGTAGAGGTGCAGTTTCATTCCTCTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTA
TTGAAAAAACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCTTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTA
ACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGCTGGTGGATCACCTGAGGACAGGAGTACAAGATTACTCTGGCCGAC
GTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTGAGCATGGTGGTCAGCACCTGTAATACTACTACTCAGGA
GTTTGAGGCAAGAGAATTGATTGAACCCAGGAGGCTGAGGTTGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGG
GTGACAGAGCGAGACTCCATCTCAAAAGAAAAAATAAAAAAAATTGGATGTAAATGCATGGATTATATCTGTGTTCTTCA
TTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACATCATGCTGTTTTGCTTACTACAGCTCTGTAACATATTTTG
AGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTGAAGTCTCAAGACAGTGGGCGTCACATACAAAAATTATG
GAAGAAAGGATCCCTGGACTCCCAGGGCCCAATGTTAGATAACAGAGTGTTGGCCATGAACCAAACTCAAAGATTTCCAC
TGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCTGTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTC
ACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGGACCCTCTTATATCCGCTTTTGGAACCCTGGGGAGGTGGAAACC
TTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACATTGTACGCCTGTCTTCTACCATCTCCGAACTCCAGATACT
CCAACAGCGAAAGGGATCTGGGCCCAACACAGGGCTCAGTGAAATCTCTTCATCTCTCATTTTATGGAGCTGAGACCTCC
TACAAGCTAGAAGAATGATTGCCAATCTGACATCCTTCTCAGGAAAAACGCAATGTTTGTTCTGCTTGCATTCCTAACTG
GAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGAAGCGAACATCTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCAC
TTGCCAAGGAATGAGCTCCTGTTGGTCATGAAACAACCCTGGCTGACTCAGCAGAGCAAGAGCCTTGCCGTAACAGAGAA
CAGAGCTCATGCACGCACACTTTGACTCACTGACTTATTCAGCCACGGCCCCATGCTCAGGTTGTGCAGTGTGGAAGCTT
TTCCTATTGTTGCCATAACAAATTTCCACAAGATTCGTGGGTGAAAACAAAACGGTTATTTAATTATCTTACAGTGCTCT
AGCTCAAAGCATGAAGTGCATCTCACTGGGCTAAAATCAAGATGACAGCAAGCCTGCCTTCCCTCTGAGGATTCCAGGCA
AGAATCTGCTTCTCACTTGTCCCATCTTATAAAGGCTCCCAGTTCCTTGGCTGCTGGTCCCTTTCCTCCTTCCTCAAAAC
CCACAAAGACTGGTCACATCTCACATGGCATCACTCAGACCCTTCTTCCTTACCACACCTCTTTCTCTGAATGCTGCTCT
CCCTTCTTCCTCATCTTTTGAAAACTTGGGGATTCTATTGGGTTCACCAAGATGAAAATCCGTCATAATCTCCCGGAAAT
CATTCAGGATACCCTTGTTTTAAGTTCAGCTGATTAGCAACCATAATTCCATCTGCAATCTTCATTCCTCCTTTCCATGT
AAAATAACATATTCACAAGCTATGGAGGCTAGGACAGGGACATTTTGGGGTGGGACAGCATTCTCCTGCCTTCCACAAAT
GGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGACACTGATATTGCAGATGGTTAAATGGGAGGACAGAAAATGAATGC
ACAAGTGGACCAATAAATGAATGATCCATTGGGAAGCATCTGTGCATGAAATCTATTTGTTTGTTTGTTCGTTTGTTTAT
TGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAGTGCAGTGTCACGATCTTGGCTCACTGCAACCTGCGTCTCCTGGAT
CCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGCTGGGATTACAGGCAACTGCCACCATGCCCGGCTAATTCTTTTTGT
ATATTTTTTGTAGAGAGGATGTTTCACCATGTTGGCCAAGCTTGTCTGAAACTCCCAACCTCAAGTGATCCGACCATCTC
AGCAACCCAAAGTACTGGGATTACAGGCGTGAGCCACTTTGCCCAGCCAGAATTCAAAATAAATAATAGATAATGCTGAG
TGTATAATTTTGGGTGACAGAGAAGGTCTCACTAATCAGATATTTGTGACATTAATGAAAAACACGGATTGAACCCCTGA
AAGATTGGCGGAAGGATTTTCCACACACAGCTGTCAGCTGTGAAGGCACAAAGGTGAAAACAATCTGATGTTGAAGGAAG
AGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGAGAATGACAAGATGACTGTAGAGAGATGGAGAGCACTCTGGGTACA
CAGGAAACTAAGGAGGAACAAGGAGTGTGTGTTTGACACTCACAGCCATTGGATTCACCTCGGGGTAACCAGGAATCCCT
ACATGATTAATAGTGACTGACAAGAAAATAAGGGAGGCCCAGGTGCGTAACTGGAATCTAGGAGACTGTGGAAAAGGCAA
TTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTAGACACTAAATGAATGAAGTAGATGGATATAAGATATGCTTGTGAG
GTAGAATCATTGGCTGGAAAGGCTTGCTGGGTTTGATTTTCCTACTTGTTTAATCCTCGCTTAATTAATTTCTTTCTGAG
ATTTATTCATCCTACACATAAATCAATACCTGGCAAAGGAGTGACAGATATATGAGGGGTGGTGGAAATGAAGGGACCTA
TTATAGCATAATATACAAGTCTGTGAACGGTGGCTCATGCTTGTAACCCAGCCCTGCAGGAGGCCAAGGCGGGTGGATTC
CATGAAGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAAACCCTATCTGTACTAAAAATACAAAAATTAGCCGAGC
ATGGTGGTGCATCCCTGTAATCCCAGCTCCTACTCTGGAGGATGAAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGT
TGCAGTGAGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAA
ATGCATAAATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTCTATTTCTCTATAATTA
CTTCTTTGATCCTTTATCTTATCCATTAGGCAATCAGCCTAAAACCTCTTCCCTATTTGGCTTTCTGTGAGCATGAGATC
ACATAGAAAATGTGAAAGCCCGCTGAATCCTCCAGCACGGATCCTGGAATAGAGAAAGTGCTCTGGTCATCGCAAAAAAA
AACTTGCCCACTCACCCAAATCGCCCACCTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGA
AACATTAATATTCCTTGGAGTGAGTCCAGATCTTGGAATCAGAGATCAGCGACAGCACTAGCTCCTGTTCCCCTTTCCTA
CTAATTCACAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCGGGTAGAAC
AGCAGCCTAACATGTGTCTCCCGAGATCACAAAGAGCAGCACATTTCACACGGGCTTCAACACTATTTTCTGGCTGTTTG
ACATAAGAGAATCTTGCTTCGCTATTTTTAATCGTGATTTCACCTTTGTTTCCTTTCCTTGGTGAATGCAATTTGTTTGA
CTCAAGAATGCTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTATCAATCCCAGTGCAGTCTTCCCAGAGAAGACT
CTAAACAAATCCTGGACTGCACCTGGGCCTATGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGA
GGATACGTTACATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGACAACAGAAGCCTGCATTTCAATGTGAGCCAG
TCCCTCAAGGCTCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAACTGGGGGAAGCCAGAAAGCAG
CCCAGCCTGGGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACA
GGAAGACAGCCCAGGCTGTTCTGAGACATTCCTCCTGATCTCAGGATGTTGCTATCTTAGTCCATTTTTGTTGCTCTAAA
GGAACACTTGAGCCTGGGTAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACAGTTCTGCAGGCTGTACTGGAAGCATGG
CACCAGAATCTATTTCTCTTGACGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGAC
CGCAGAGATCACACGGCAAGAGAGAGAGTAAGGGGGAGAGGGAGCGATGGAGCTTCCAAGCTCTTTTTAACAACCAGCTC
TCCAGGAACTAACAGAGGGGGAACTTGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCC
ATGACCCAAACACCTCTGAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAAGGGTCAAACA
TCTCAACTAAAGTAGTTGTATCCTCAGCACGTTCTATGGTTACTATGAGAGCTATAATTGAGAAAGCAGGGGAAAGCTAG
GTCTCCCGCCATTTGGGTGCTTGTCCTAAAGAGACGTTGTATGTGGTTACCTGCCAATCAAGAAATGCGAGACAATTCAT
AAAGAGGAACTGCTATGATTAGCTTCTTATTGGTGTCTCCTCTTCTTCCAGGTAACCCCAGACACCTACATGTTCTGATT
GGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAGTAA
GTCTCACGAAGCAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACGCGGATGTGTGTTCCTCACCA
GCAGGATGGTCCCTGGCCCAAGACAGGAGCCACAGAGGCAGGACTTTCTAGAGAGAGCACCAGATTCCCTTCCCCTGCCT
TCAGCTCACAGACCATTGCCTGATTCTGAACTGTATCCTCACGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCAT
GACAGGCAGAAAGTGGGAGATAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAACTCAGAGAG
ATAGAATGTCTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTA
TGAAATGAGGACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTTCTACAGATGCTGCTGTAATGGACCAAGA
GCCTGCAGGGAACAGAACAGTGAACAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTCTTATTCCCAAAGAGT
CCTGAAAAATGTGAGCACCCTCCCTCACTCAGCATTTCCCTCTCTCCAGGATTCTGATGAACAAGACCATCAGGAGGTGT
CATACGCATAATTGGATCACTGTGTTTTCACACAGAGAAAAATCACTCGCCCTTCTGAGAGGCCCAAGACACCCCCAACA
GATACCAGCATGTACATAGAACTTCCAAATGCTGAGCCCAGATCCAAAGTTGTCTTCTGTCCACGAGCACCACAGTCAGG
CCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATC
TGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCTTCCTCACACCACGAATCTGAACATGCCTCTCTCTTGCTTACAAAT
GTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTG
CCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACCTGAGGCTGCAATCACACTGAGGAACTCACAATTCCAAACA
TACAAGAGGCTGCCTCTTAACACAGCACTTAGACACGTGCTGTTCCACCTCCCTTCAGACTATCTTTCAGCCTTCTGCCA
GCAGTAAAACTTATAAATTTTTTAAATAATTTCAATGTAGTTTTCCCGCCTTCAAATAAACATGTCTGCCCTCATNlib/
2ds4genomiclib:2DS4_0010106GTTTGGGAGGTTGGATCTAAGACATGTTTTGAGTTGGTCATAGTGAAGGACGC
GAGGTGTCAATTCTAGTGAGAGCAATTTCCAGGAAGCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAG
GTAGAAAAAGCCTGCGTACGTCACCCTCCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCC
TGTGCGCTGCTGAGCTGAGCTGGGGCGCGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCATCATCATGGC
GTGTGTTGGTGAGTCCTGGAAGGGAATAGAGGGAGGGAGCGTGGGGATGGAGATCTGGGCCCAGAGGTGGAGATATGGGC
CTGGAGGTGGAGTTATGGGCCTGGAGTGGAGATCTGGGCCTAGAGATGGAGTGATGAGCCTAGAAGTGGAGATCTGCGCC
TGGAGTGGAGATCTGGGCCTGGAGTGAAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGGGATAGGAACCTGGA
GTGGAGAGAGGAACCTGGAGGAGAGATAGGAACCTGGAGGGGAGGTAGGAGCCTAGGGTGGAGATATGGGACTGGAGTGG
AGATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGA
TACGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGTCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATG
GGTCTGCAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGACTGGAGTGGAGATATGGGA
CTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTG
GAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAG
TGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGG
AGATCTGGGCCTACGGTGGAGATATGGGCCTAGGATGGGGATATGGGCCTGGAATGGAGATATGGGCCTGGGTGTGGAGA
TATGGGACTGGAGTGGAGATATGGGCCTGATGTGGAGATATGGGCTTGGAGTGGAGATATGATCCTGGAGTGTAGTTATG
GGCCTGGAGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTGGAGAGGAGATATGGGA
CTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGATTGGAGATATGGGCCGAGGGTGGAGATCTGAGCCTGG
ATTGGAGATGTGGGCCCGGATTGGCTATATGGGTCTAGGGTGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTG
GAGATATGGGCTTGGGGTGGGGATATGGGCCTGGAGGCTGGGTCTCTGCACAGCCGAGAGCACTGTTCTTGGGTGCAGGT
AGGCACTGATGGTGAGTTTCCCTTCGGCCCAGGAAGGGGCTGGCTATCAAGACTCACAGCCCAGTGGGGGCAGCAAGGAA
GGCCTTGTTTGCCTGCAAATGGATCTTCCATCATGATCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACA
GGAGGGTAAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGAAACGGGAGGGAAGTCCTG
TCAGGGAGTCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCCACAGTTCCGACCTTGCCTCCCTGGCCTCT
CAACCCCTTGGCAGAGTCAAGTTGTGTGGGGACCAGGGTTGGACTAGGGTGTTCAAAGCTGGGTTGTGTGGTGGGGAAGT
GGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACACTTCAGCGTTTCCATGACGGTAGGGGCTGCAGTGT
GGCTGCTGTCATTCTACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACATTCCAAATCCTCTGATGGGGGCTAAGT
TTTTTATTATCATTCAGGCAACTGCTGATATTCCATTCTCAAAGGACATGCCCTCCACTTCATGTCTACCCTGTGTTGTT
TTATGTCAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTT
TTGTTGTACGGAGACACCTTGTCTTTGTGGGATGGGTCCTTCCTTTAGCCCTAGGCACCAAGGTGTGATAGCAGCCATAG
AAATGTGGAAAGTGGGGAGAATCTTCTGAGCACAGGGAGGGAGGCACAGCTCCACATCCTCCTCTCTAAGGCGGCGCCTC
CTTCACCCCAAGGTGGTCAGGACAAGCCCTTGCTTTCTACCTGGCCCAGCCTTGTGGTGCCTCCAGAACATGTGACTCTT
CAGTGTCACTCTAATCTTGGGTTTAACAACTTCAGTCTGTACAAGGATGATGGGGTGCCTGTCCCTGAGCTGTACAACAG
AATATTCTGGAAAAGCCTTTTCATGGGCCCTGTGACCCCGTCACATGCAGGGACCTATAGATGCCGGGGTTCACACACAC
ACTCCCCCAGTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCT
CCTTGTCCCACCTCCTGAATCCCAGAGCTTCTGGTAGGCATGTCCTTGAGGGTCCCATCACGCAGGCCCTAACTGTATTT
GGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAAGTGTCCCCAGTGATGACTGCATTCTAA
TCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGGACTGAAGGGGAAGATGGAGCTCAGGTTGTTGATGAGTTGAC
CTTGAGATGGGGAGACAGCCTGGACTGTCCCGGTGGGCTCAGTATAATCACAAGTGTCCACATGAAAGGAGGAGGAAGAG
GAGAGTGGGGATTAGAGCAGCGTAGTGGGAGACTCCATCAGCTTTGAAGGTGGATGAAGGCCATAAGCCATGAATGCAGG
TGGCCTATAGAGGCTGGGAAAGTCAAGTAACTGATTCTCCTGAGTCTCCAGAGGGAACACAGCCCTGCAGATGCCTTGAT
TTTAGCCCTCGAAAAACAGGGTCCGCTTTCTGTCTCCAGAATCGGAGGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTT
CTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGACAAGTTAAGAAAAGACACAAGGATA
GCCAGGCATGGTGGCAGGTGCATGTAATCCTAGCGACTCGGGAGGCTGAGAGCAGGAGAATCGCTTGAACCCAGGAGACA
GAGGTTGCAGTGAGCGTAGACCACACCACTTCACTCCAGCCTGGGTGAAGGAGTGAGACTCTGTCTCCAAAATTAATTAA
TTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTGCACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCT
CCATCCACATAGGGAGGGGTTGATACTCCTCAAATCAGCACGAGGAGCCAGCCTATGGAAACTGGCACCATGGAGAAGGC
ACAGACATGGCAAGAGTGGCTCCCAGTCCCCACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTC
ATACCTCCTGCCAAGGATTCCAATTCGTCCAAAAGAGATTGAACCAGGCTGCTAAGAGCCGGGACGTGCAGCCTATCCTG
CTTCCTCTTCCACTCCCACATAGACAGTAAGAAAGACATTAGTGTGAAATAGATACAACAGCCCAAGAGATGAGGCTGAG
CCCAGTGGGAAGGGAATCACAGCTACTAGAGACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGCACCA
GGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGCAGAGAGACAGACACCAGCGAAGGGAAGGCTCACTC
ATTCCAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAACCTCTCTTCCTAGGAGTCCACAGAAAA
CCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCGGATGTCATGTT
TGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTTGCACCTCATTGGAGAGCACCATGATGGGGTTTCCA
AGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCCTTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCC
TATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATGGTGATCATAGGTGAGAGTGTCCAGACATTCTTCTCATTGTCATT
GGGATGCAGAGTGAATGATCCAGGACTTGGAGACCCAGGTGGTTGTAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAG
ACTGACTTGGTGAGGTCTGTGCCAACAGAGACAGAGAAACAAGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACA
AACACAGGGGCCATACAGGGAGTTAGAAAAGACAGAAAGAGTTAAAGGAGACAGACAGACATGTCCCAGACAGAGGTGTC
CTTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTGTTCTCTAC
CAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGGCCTCAGGCCTTGTGGCACCTACAGATGCCA
TGCTTATTCTGACACCTCTGACTTCCATGCAATGGAGAATAATCGTCCCAAAATATCATGGCCCCAGAACACCAACCCCT
GTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATCACATATGAGAG
GATCACTGAGAAGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACACACAGAGAAAGAGCCAGAGGAAGG
AGATTGAGAGACTCACAGACACATAAAGAGAGAGAAGAGGGCAGAGAAGTGGAGAGAATGATGGAAGAGAGCAGAGAAAA
CCACTAAAATTAGAGTCCTGAGGGCGAGGCACAAGGGCATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAA
AGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATACAGATAGATGATGGATAGATATAGAT
AGATGATATATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGATTGATTGATTCATTAATAGATGATACA
TAGAGATGATGATGATGAAGATAGATGGATAGATAATACATAGAGATAGAGAGGAAGACAAAGAGAGAAATAATAGAGAG
AGAGAGATGATACATATATATAGATAATAGATGATTGACGGATAGACAATTGATAGATAAATAGATGATATATAGATATA
GATGACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATGGATTGATAGATAATAGATAGAAATATGCAGA
AAGTTATGAACGGGACACAAACTGAGAAACTCAGAGTTAAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGCCAGA
GAGAATAAAACAATCCAAAAAAGGAAAACATAACTAGAGGTAGGGAAGTGAGGTCAGAGACCTACAGAGACAGAGAAGGT
GGAAGGAGGAAATAGACATGAAGAGAGATAGGGTGGAGGGTGAGACAGAGAAAGAGAGCATTAGGCCATAGAGCAGGGGA
GTGAGTTCTCAGGTCAGGTGTGAGGGGAGCTGTGACAAGGAAGATCCCCCCTGAGGAAACTGCCCCTTCTCCTTCCAGGT
CTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTC
CCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCA
ACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGAC
GCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTGCTTGTTTCCGTCACAGGTGAGGAAACCCCATATCTGTCCCATGT
CCTATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGATGATGGAGAGAAGCATGGACAGATGCAGAGAGAAGACGCA
GCATGCCTGTGAGGGAGGGATCAGGGCGCAGGATGGCACACACAGCACCTCCAAACCCTCCTGCATGGCCTGCATGGAGG
CCTCCGATTAGGGCTCCAGAAACCCAGGCAGATGTAGAAAGCGGTCAGGAGAGACCCAGAGAAGGGGAGACTGGGCTCAG
TTTGGGGAGATCAGAGGTTCCCTCAGCCCCTCAACCTTACCCATTTCCCAGAAGCCCTTCCTGGCCTCTCACCCACACAG
AGATGTCATCACCAGCAACCCCTACATCCTTTTCTTTTTGTTTGAAAAAATATTCATTGAGGTTAAATATACCTATATAG
CTTACCACTTTTAACATTTTTTTTTTTTTGAGGTGGAGTCTAGCTCTGTCTCCTATGCTGGAATGCAGTGGCACAATCTC
AGCTCACTGTAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCACCTGAGTAGCTGGTACTACAGGCGCCC
ATCACCACGCCGGGCTACTTTTTGTATATTTAGTAGAGAGGGGGTTTCACCATGTTGGTCGAGCTGCTCTGGAACTCCTG
ACCACGTGATCCACCCGCCTCAGGCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCCACGTTTACCAA
TTTTAAGTGTAAGGTCTAGTGGTCATAAATACATACATATAAATTTTTTGTTTGTTTGTTTTATCCTCCACCCTTTTCTT
CCTGGCCTCTGGTAGCCACCATTCTACTCTCTATCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTGAGAAATGA
GAATATTTGTAATGACTTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTATTCTTTCTATGGATGAGTAGTCTC
CGCTGTGCGTATGTACTACATTCTCTCTATCCATTCATCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTG
TGAAGAGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATACATTGATTTACTTTCCTTTGGATATAAACCCAGT
AGTGAAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCC
CTCTGTGCCCAGGCTGGAGTACAAGTGATGTGATCTTGGCTCATTGCAACCTCCGCCTCCTGGGTTCAAATGATTTTCCT
GCCTCAGCCTCCCTAGTAGCTGGGATTACAGGTGCACGCCACCATGCCGGGATACTTTTTGGTTTTTTTTAGTGTACATG
GGGTTTCCCCAGGTTGGCTAGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGG
GATTACAGGCATGATCCACTTCATCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCATACTTTTCTCCGTAATGGCTGTA
CTAATTTACACTCCTACCAACAGGGTACCAGGGTTCTCCTTTCTCTACCACCTTGCCAGCATTTGTTTTGCCTGTCTTGC
AGCTAAAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGGAGTGCAGTGGT
GCGATCTCGGCTCACCGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTAC
AGGCACACGCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGCGTTTCTCCATGTGGGTCAGACTGGTCTCA
AACTCCCGACCTTATGAGATTCGCCCACCTCGGGCTCTCAGAGTTCTAGGATGACAGACGTGAGCCACCTCGCCCGGCCT
AAAAGCCATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTCGCGTTTCTCTGATGATGAGTGATACTGAGCA
CTTTTTCGTATGTGGGGAAATTTCATGTCTTTTGCTCCTTTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTT
CTTATACTTCTAGTTATTAATCCCGTCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCAC
TTTGTTGGTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTG
TGTTTTGAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAATGTACTGGAGCATTTCCCCAATATTTTCTTCTACGTGTT
TCACAGGTTCAGGCCTTAGACTCACATCTTTAATCCACTTTCATTTGATTTTTGTGTATGGTGACAGGTAGAGGTGCAGT
TTCATTCCTCTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAAACTGTCCTTTCCTGATTGTGAGTTCTT
GGCACCTTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTAACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGC
TGGTGGATCACCTGAGGACAGGAGTACAAGATTACTCTGGCCGACGTGATGAAACATCGTCTCCACTAAAAATATAAAAA
TTAGCTGAGCATGGTGGTCAGCACCTGTAATACTACTACTCAGGAGTTTGAGGCAAGAGAATTGATTGAACCCAGGAGGC
TGAGGTTGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTCAAAAGAAAAAAT
AAAAAAAATTGGATGTAAATGCATGGATTATATCTGTGTTCTTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGC
CAACATCATGCTGTTTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTA
TACCTTGAAGTCTCAAGACAGTGGGCGTCACATACAAAAATTATGGAAGAAAGGATCCCTGGACTCCCAGGGCCCAATGT
TAGATAACAGAGTGTTGGCCATGAACCAAACTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTC
TCTCCTGTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACA
GGACCCTCTTATATCCGCTTTTGGAACCCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTC
TGACATTGTACGCCTGTCTTCTACCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGGCCCAACACAGGGC
TCAGTGAAATCTCTTCATCTCTCATTTTATGGAGCTGAGACCTCCTACAAGCTAGAAGAATGATTGCCAATCTGACATCC
TTCTCAGGAAAAACGCAATGTTTGTTCTGCTTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGG
GAAGCGAACATCTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCAAGGAATGAGCTCCTGTTGGTCATGAAACA
ACCCTGGCTGACTCAGCAGAGCAAGAGCCTTGCCGTAACAGAGAACAGAGCTCATGCACGCACACTTTGACTCACTGACT
TATTCAGCCACGGCCCCATGCTCAGGTTGTGCAGTGTGGAAGCTTTTCCTATTGTTGCCATAACAAATTTCCACAAGATT
CGTGGGTGAAAACAAAACGGTTATTTAATTATCTTACAGTGCTCTAGCTCAAAGCATGAAGTGCATCTCACTGGGCTAAA
ATCAAGATGACAGCAAGCCTGCCTTCCCTCTGAGGATTCCAGGCAAGAATCTGCTTCTCACTTGTCCCATCTTATAAAGG
CTCCCAGTTCCTTGGCTGCTGGTCCCTTTCCTCCTTCCTCAAAACCCACAAAGACTGGTCACATCTCACATGGCATCACT
CAGACCCTTCTTCCTTACCACACCTCTTTCTCTGAATGCTGCTCTCCCTTCTTCCTCATCTTTTGAAAACTTGGGGATTC
TATTGGGTTCACCAAGATGAAAATCCGTCATAATCTCCCGGAAATCATTCAGGATACCCTTGTTTTAAGTTCAGCTGATT
AGCAACCATAATTCCATCTGCAATCTTCATTCCTCCTTTCCATGTAAAATAACATATTCACAAGCTATGGAGGCTAGGAC
AGGGACATTTTGGGGTGGGACAGCATTCTCCTGCCTTCCACAAATGGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGA
CACTGATATTGCAGATGGTTAAATGGGAGGACAGAAAATGAATGCACAAGTGGACCAATAAATGAATGATCCATTGGGAA
GCATCTGTGCATGAAATCTATTTGTTTGTTTGTTCGTTTGTTTATTGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAG
TGCAGTGTCACGATCTTGGCTCACTGCAACCTGCGTCTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGC
TGGGATTACAGGCAACTGCCACCATGCCCGGCTAATTCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCACCATGTTGG
CCAAGCTTGTCTGAAACTCCCAACCTCAAGTGATCCGACCATCTCAGCAACCCAAAGTACTGGGATTACAGGCGTGAGCC
ACTTTGCCCAGCCAGAATTCAAAATAAATAATAGATAATGCTGAGTGTATAATTTTGGGTGACAGAGAAGGTCTCACTAA
TCAGATATTTGTGACATTAATGAAAAACACGGATTGAACCCCTGAAAGATTGGCGGAAGGATTTTCCACACACAGCTGTC
AGCTGTGAAGGCACAAAGGTGAAAACAATCTGATGTTGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGA
GAATGACAAGATGACTGTAGAGAGATGGAGAGCACTCTGGGTACACAGGAAACTAAGGAGGAACAAGGAGTGTGTGTTTG
ACACTCACAGCCATTGGATTCACCTCGGGGTAACCAGGAATCCCTACATGATTAATAGTGACTGACAAGAAAATAAGGGA
GGCCCAGGTGCGTAACTGGAATCTAGGAGACTGTGGAAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTA
GACACTAAATGAATGAAGTAGATGGATATAAGATATGCTTGTGAGGTAGAATCATTGGCTGGAAAGGCTTGCTGGGTTTG
ATTTTCCTACTTGTTTAATCCTCGCTTAATTAATTTCTTTCTGAGATTTATTCATCCTACACATAAATCAATACCTGGCA
AAGGAGTGACAGATATATGAGGGGTGGTGGAAATGAAGGGACCTATTATAGCATAATATACAAGTCTGTGAACGGTGGCT
CATGCTTGTAACCCAGCCCTGCAGGAGGCCAAGGCGGGTGGATTCCATGAAGTCAGGAGTTCCAGACCAGCCTGGCCAAC
ATGGTGAAACCCTATCTGTACTAAAAATACAAAAATTAGCCGAGCATGGTGGTGCATCCCTGTAATCCCAGCTCCTACTC
TGGAGGATGAAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGTTGCAGTGAGTGGAGATTGCATCACTGCACTCCAGC
CTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAAATATAATAAAACACACACGAATGACAA
AGGCACCTGAATTCCAATCATCGTTTTTCTATTTCTCTATAATTACTTCTTTGATCCTTTATCTTATCCATTAGGCAATG
AGCCTAAAACCTCTTCCCTATTTGGCTTTCTGTGAGCATGAGATCACATAGAAAATGTGAAAGCCCGCTGAATCCTCCAG
CACGGATCCTGGAATAGAGAATGTGCTCTGGTCATCGCAAAAAAAAACTTGCCCACTCACCCAAATCGCCCACCTCACCC
CTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGAAACATTAATATTCCTTGGAGTGAGTCCAGATCTTG
GAATCAGAGATCAGCGACAGCACTAGCTCCTGTTCCCCTTTCCTACTAATTCACAGGAGGACAGGTGGTATTGAAGCAAT
AGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCGGGTAGAACAGCAGCCTAACATGTGTCTCCCGAGATCACAAAGA
GCAGCACATTTCACACGGGCTTCAACACTATTTTCTGGCTGTTTGACATAAGAGAATCTTGCTTCGCTATTTTTAATCGT
GATTTCACCTTTGTTTCCTTTCCTTGGTGAATGCAATTTGTTTGACTCAAGAATGCTGTGGATGTAGAAATCCTAAAGCA
CATTCGCTGTGTATCAATCCCAGTGCAGTCTTCCCAGAGAAGACTCTAAACAAATCCTGGACTGCACCTGGGCCTATGCC
AATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGGATACGTTACATAGGCAGGTTCATTACTAACAGA
TAAGCAGCGAGTGACAACAGAAGCCTGCATTTCAATGTGAGCCAGTCCCTCAAGGCTCAGAAAAGCTGCTCGGGACATAT
GGAGTCACCCCATTTGCAGTGTAACTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAGCCACAGGAA
GCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCCAGGCTGTTCTGAGACATTCCTCC
TGATCTCAGGATGTTGCTATCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCTAAAGAAAAG
AGATTGGTTTGCCTCACAGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGAATCTATTTCTCTTGACGGCCTCAGGCTG
CTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCGCAGAGATCACACGGCAAGAGAGAGAGTAAGGGG
GAGAGGGAGCGATGGAGCTTCCAAGCTCTTTTTAACAACCAGCTCTCCAGGAACTAACAGAGGGGGAACTTGCTAACCCC
GTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAACACCTCTGAAGAGGCCCAACCTCCC
ACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAAGGGTCAAACATCTCAACTAAAGTAGTTGTATCCTCAGCACGTTCT
ATGGTTACTATGAGAGCTATAATTGAGAAAGCAGGGGAAAGCTAGGTCTCCCGCCATTTGGGTGCTTGTCCTAAAGAGAC
GTTGTATGTGGTTACCTGCCAATCAAGAAATGCGAGACAATTCATAAAGAGGAACTGCTATGATTAGCTTCTTATTGGTG
TCTCCTCTTCTTCCAGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCT
CCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAGTAAGTCTCACGAAGCAGAGGCCAGAGAGCTCAGGGCCA
TGTGGGGAAGCAGGATGGGAGCACGCGGATGTGTGTTCCTCACCAGCAGGATGGTCCCTGGCCCAAGACAGGAGCCACAG
AGGCAGGACTTTCTAGAGAGAGCACCAGATTCCCTTCCCCTGCCTTCAGCTCACAGACCATTGCCTGATTCTGAACTGTA
TCCTCACGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGAAAGTGGGAGATAGAATCAATGGGAT
GGGACCTCAGAGCTATTCATGGGATGGGTCCTTGAACTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGCAACTGAGGG
ACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTCCGAGCTCTT
TTGTTGACTTCCGTCTTCTACAGATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGTAG
GTGCTCCTCGGCCCAGCCTCGTGGCTAGTCTTATTCCCAAAGAGTCCTGAAAAATGTGAGCACCCTCCCTCACTCAGCAT
TTCCCTCTCTCCAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAATTGGATCACTGTGTTTTCACACAG
AGAAAAATCACTCGCCCTTCTGAGAGGCCCAAGACACCCCCAACAGATACCAGCATGTACATAGAACTTCCAAATGCTGA
GCCCAGATCCAAAGTTGTCTTCTGTCCACGAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTG
TCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCT
TCCTCACACCACGAATCTGAACATGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACA
CACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGT
CTACCTGAGGCTGCAATCACACTGAGGAACTCACAATTCCAAACATACAAGAGGCTGCCTCTTAACACAGCACTTAGACA
GGTGCTGTTCCACCTCCCTTCAGACTATCTTTCAGCCTTCTGCCAGCAGTAAAACTTATAAATTTTTTAAATAATTTCAA
TGTAGTTTTCCCGCCTTCAAATAAACATGTCTGCCCTCATNlib/2ds4genomiclib:2DS4_0010107GTTTGGGA
GGTTGGATCTAAGACATGTTTTGAGTTGGTCATAGTGAAGGACGCGAGGTGTCAATTCTAGTGAGAGCAATTTCCAGGAA
GCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAAAAAGCCTGCGTACGTCACCCTCCCATGAT
GTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGTGCTGCTGAGCTGAGCTGGGGCGCGGCCGCC
TGTCTGCACCGGCAGCACCATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAATAGAGGGAG
GGAGCGTGGGGATGGAGATCTGGGCCCAGAGGTGGAGATATGGGCCTGGAGGTGGAGTTATGGGCCTGGAGTGGAGATCT
GGGCCTAGAGATGGAGTGATGAGCCTAGAAGTGGAGATCTGCGCCTGGAGTGGAGATCTGGGCCTGGAGTGAAGATCTGG
GCCTGGAGTGGAGATATGGGCCTGGAGTGGGGATAGGAACCTGGAGTGGAGAGAGGAACCTGGAGGAGAGATAGGAACCT
GGAGGGGAGGTAGGAGCCTAGGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGGAG
TGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATACGGGCCTGGAGTGGAGATATGAGCCTGGAGTGG
AGATATGGTCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGTTATGGGCCTGGAGTGAAGTT
ATGGGCCTGGAGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCT
GGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGT
CTGCAGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTG
GAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGA
GTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGG
AGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAG
ATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGGAGATACGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATA
TGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGG
CCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTG
GAGTGGACATATGGGTCTGGAGTGGAGATACGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGAG
GTGGTGATATGGGCCTGGAGTGTAGACATGGGCCGAGTGGAGATATGGGTCTGGAGTGGAGATATGGGCCTGGAGTGGAG
ATATGGGACTGGAGTGGAGATATAGGCATGGGGTGGAGACATGGGCCGGGAGTGGAGATATGGGACTGGAGTGGAGATAC
GGGCGTGGGGTGGAGATATGTGCCTGGAGGTGGAGATATGGGCGTGGGTTGGAGATATGGGCCTGGAGTGGAGATATGGG
CGTGGGGTGGAGATATGGGTCTGGAGTGGAGACATGGGCATGGGGTGGAGATATGGGCCTGGTGTGTAGATATGGGCCTG
GAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATCTGGGCCTACGGTGGAGATATGGGCCTAGGAT
GGGGATATGGGCCTGGAATGGAGATATGGGCCTGGGTGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGATGTGGA
GATATGGGCTTGGAGTGGAGATATGATCCTGGAGTGTAGTTATGGGCCTGGAGGTGGAGATCTGGGCCTGGGGTGGAGAT
ATGGGCCTGGAGTGGAGATATGGGACTGGAGAGGAGATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGG
GCCTGGATTGGAGATATGGGCCGAGGGTGGAGATCTGAGCCTGGATTGGAGATGTGGGCCCGGATTGGCTATATGGGTCT
AGGGTGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCTTGGGGTGGGGATATGGGCCTGGAG
GCTGGGTCTCTGTACAGCCGAGAGCACTGTTCTTGGGTGCAGGTAGGCACTGATGGTGAGTTTACCTTCGGCCCAGGAAG
GGGCTGGCTATCAAGACTCACAGCCCAGTGGGGGCAGCAAGGAAGGCCTTGTTTGCCTGCAAATGGATCTTCCATCATGA
TCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGGGTAAGTCCTTCTCCAAACCTTAGGGTGTCAT
CTCCCCACATAAGAGGATTTTCCTGAAACGGGAGGGAAGTCCTGTCAGGGAGTCTCTCATAAACTAGGAAGAGGGGACCC
TGGGGTGCTCGGCCCACAGTTCCGACCTTGCCTCCCTGGCCTCTCAACCCCTTGGCAGAGTCAAGTTGTGTGGGGACCAG
GGTTGGACTAGGGTGTTCAAAGCTGGGTTGTGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTT
ACTCACACACTTCAGCGTTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCATTCTACCAGAAGAGGTGGGAAACCA
CAGCCATGGCCCTGACATTCCAAATCCTCTGATGGGGGCTAAGTTTTTTATTTTCATTCAGGCAACTGCTGATATTCCAT
TCTCAAAGGACATGCCCTCCACTTCATGTCTACCCTGTGTTGTTTTATGTCAGTAATCTTACAGTATTAAAATCTAGTAG
GAGTCTCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTACGGAGACACCTTGTCTTTGTGGGATGGG
TCCTTCCTTTAGCCCTAGGCACCAAGGTGTGATAGCAGCCATAGAAATGTGGAAAGTGGGGAGAATCTTCTGAGCACAGG
GAGGGAGGCACAGCTCCACATCCTCCTCTCTAAGGCGGCGCCTCCTTCACCCCAAGGTGGTCAGGACAAGCCCTTGCTTT
CTACCTGGCCCAGCCTTGTGGTGCCTCCAGAACATGTGACTCTTCAGTGTCACTCTAATCTTGGGTTTAACAACTTCAGT
CTGTACAAGGATGATGGGGTGCCTGTCCCTGAGCTGTACAACAGAATATTCTGGAAAAGCCTTTTCATGGGCCCTGTGAC
CCCGTCACATGCAGGGACCTATAGATGCCGGGGTTCACACACACACTCCCCCAGTGGGTGGTCGGCACCCAGCAACCCCC
TGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAATCCCAGAGCTTCTGGTA
GGCATGTCCTTGAGGGTCCCATCACGCAGGCCCTAACTGTATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGC
TGTGGTGGGAAGAATAAGTGTCCCCAGTGATGACTGCATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAA
GGGACTGAAGGGGAAGATGGAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGGTGG
GCTCAATATAATCACAAGTGTCCACATGAAAGGAGGAGGAAGAGGAGAGTGGGGATTAGAGCAGCGTAGTGGGAGACTCC
ATTAGCTTTGAAGGTGGATGAAGGCCATAAGCCATGAATGCAGGTGGCCTATAGAGGCTGGGAAAGTCAAGTAACTGATT
CTCCTGAGTCTCCAGAGGGAACACAGCCCTGCAGATGCCTTGATTTTAGCCCTCGAAAAACAGGGTCCGCTTTCTGTCTC
CAGAATCGGAGGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACA
CTGGAACCCAGGTCAAGGACAAGTTAAGAAAAGACACAAGGATAGCCAGGCATGGTGGCAGGTGCATGTAATCCTAGCGA
CTCGGGAGGCTGAGAGCAGGAGAATCGCTTGAACCCAGGAGACAGAGGTTGCAGTGAGCGTAGACCACACCACTTCACTC
CAGCCTGGGTGAAGGAGTGAGACTCTGTCTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTA
CACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAATC
AGCACGAGGAGCCAGCCTATGGAAACTGGCACCATGGAGAAGGCACAGACATGGCAAGAGTGGCTCCCAGTCCCCACCAG
GAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTCCTGCCAAGGATTCCAATTCGTCCAAAAGA
GATTGAACCAGGCTGCTAAGAGCCGGGACGTGCAGCCTATCCTGCTTCCTCTTCCACTCCCACATAGACAGTAAGAAAGA
CATTAGTGTGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGTGGGAAGGGAATCACAGCTACTAGAGACAGA
GGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAG
AGAGGAAGCAGAGAGACAGACACCAGCGAAGGGAAGTCTCACTCATTCCAGGTGCCATGGATGGGATGATAAAGAGAGAC
ACCTTCTAAACTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAA
TCAGAAGAGACAGTCATCCTGCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAA
CAACACTTTGCACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCC
TTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATG
GTGATCATAGGTGAGAGTGTCCAGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCAGGACTTGGAGACCC
AGGTGGTTGTAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTGCCAACAGAGACAGAG
AAACAAGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAAACACAGGGGCCATACCGGGAGTTAGAAAAGACAGA
AAGAGTTAAAGGAGACAGACAGACATGTCCCAGACAGAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACAGG
TTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGA
GTTGGGCCCTGTGGCCTCAGGCCTTGTGGCACCTACAGATGCCATGCTTATTCTGACACCTCTGACTTCCATGCAATGGA
GAATAATCGTCCCAAAATATCATGGCCCCAGAACACCAACCCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATT
CTGAGGCTCACATTCCAAATAACCCCACATATCACATATGAGAGGATCACTGAGAAGCACAGAGAGAAATCAGGGACACC
AAAAAGCAAAGACATAAACACACAGAGAAAGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAA
GAGGGCAGAGAAGTGGAGAGAATGATGGAAGAGAGCAGAGAAAACCACTAAAATTAGAGTCCTGAGGGCGAGGCACAAGG
GCATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAG
ATGATAGATGGATAGATACAGATAGATGATGGATAGATATAGATAGATGATATATAGGTAGATGATAGATAATAGGTTAT
AGATACATAGATGATGATTGATTGATTCATTAATAGATGATACATAGAGATGATGATGATGAAGATAGATGGATAGATAA
TACATAGAGATAGAGAGGAAGACAAAGAGAGAAATAATAGAGAGAGAGAGATGATACATATATATAGATAATAGATGATT
GACGGATAGACAATTGATAGATAAATAGATGATATATAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCGAAT
AGATAAATAGATGGATTGATAGATAATAGATAGAAATATGCAGAAAGTTATGAACGGGACACAAACTGAGAAACTCAGAG
TTAAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGCCAGAGAGAATAAAACAATCCAAAAAAGGAAAACATAACTA
GAGGTAGGGAAGTGAGGTCAGAGACCTACAGAGACAGAGAAGGTGGAAGGAGGAAATAGACATGAAGAGAGATAGGGTGG
AGGGTGAGACAGAGAAAGAGAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCTCAGGTCAGGTGTGAGGGGAGCTGTGAC
AAGGAAGATCCCCCCTGAGGAAACTGCCCCTTCTCCTTCCAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGC
CCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGA
AGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTG
CCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTG
CTTGTTTCCGTCACAGGTGAGGAAACCTCATATCTGTCCCATGTCCTATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTG
CTGATGATGGAGAGAAGCATGGACAGATGCAGAGAGAAGACGCAGCATGCCTGTGAGGGAGGGATCAGGGCGCAGGATGG
CACACACAGCACCTCCAAACCCTCCTGCATGGCCTGCATGGAGGCCTCCGATTAGGGCTCCAGAAACCCAGGCAGATGTA
GAAAGCGGTCAGGAGAGACCCAGAGAAGGGGAGACTGGGCTCAGTTTGGGGAGATCAGAGGTTCCCTCAGCCCCTCAACC
TTACCCATTTCCCAGAAGCCCTTCCTGGCCTCTCACCCACACAGAGATGTCATCACCAGCAACCCCTACATCCTTTTCTT
TTTGTTTGAAAAAATATTCATTGAGGTTAAATATACCTATATAGCTTACCACTTTTAACATTTTTTTTTTTTTGAGGTGG
AGTCTAGCTCTGTCTCCTATGCTGGAATGCAGTGGCACAATCTCAGCTCACTGTAACCTCCGCCTCCTGGGTTCAAGCGA
TTCTCCTGCCTCAGCCACCTGAGTAGCTGGTACTACAGGCGCCCATCACCACGCCGGGCTACTTTTTGTATATTTAGTAG
AGAGGGGGTTTCACCATGTTGGTCGAGCTGCTCTGGAACTCCTGACCACGTGATCCACCCGCCTCAGGCTCCCAAAGTGC
TGGGATTACAGGCATGAGCCACCGCGCCCGGCCACGTTTACCAATTTTAAGTGTAAGGTCTAGTGGTCATAAATACATAC
ATATAAATTTTTTGTTTGTTTGTTTTATCCTCCACCCTTTTCTTCCTGGCCTCTGGTAGCCACCATTCTACTCTCTATCT
TCATGAGATCCACCTTTTAGCTCCTGTATATGGGTGAGAAATGAGAATATTTGTAATGACTTCCAGTTCCATCCATGTGG
CTGCAAATATCAGGATGTTATTCTTTCTATGGATGAGTAGTCTCCGCTGTGCGTATGTACTACATTCTCTCTATCCATTC
ATCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTGAAGAGTGCTGCACCAATCATACGAGTGCAGATAT
CACTTCGATACATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGAAATTGCTGGATACTATGAAAGTTCTCTTTTT
AGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTGTGCCCAGGCTGGAGTACAAGTGATGTGATCT
TGGCTCATTGCAACCTCCGCCTCCTGGGTTCAAATGATTTTCCTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGTGCA
CGCCACCATGCCGGGATACTTTTTGGTTTTTTTTAGTGTACATGGGGTTTCCCCAGGTTGGCTAGGCTGCTCTCAAACTC
ATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTACAGGCATGATCCACTTCATCCAACCTCTTTT
TAGTTCTTTAAAGGACTTCCATACTTTTCTCCGTAATGGCTGTACTAATTTACACTCCTACCAACAGGGTACCAGGGTTC
TCCTTTCTCTACCACCTTGCCAGCATTTGTTTTGCCTGTCTTGCAGCTAAAAGCCATTTTATTTTATTTCATTTTATTTT
GAGATGGAGTTTCGCTCTTGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACCGCAACCTCCACCTCCCAGGT
TCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACACACCACCACGCCCGACTAATTTTTGTATT
TTTAGTAGAGACAGCGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCCCGACCTTATGAGATTCGCCCACCTCGGGCT
CTCAGAGTTCTAGGATGACAGACGTGAGCCACCTCGCCCGGCCTAAAAGCCATTTTAATGGGGTGAGATGAAAACTCACT
TTGATTTTAATTCGCGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTCGTATGTGGGGAAATTTCATGTCTTTTGCT
CCTTTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATACTTCTAGTTATTAATCCCGTCTCAGATGCA
TAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTGGTTTATTTTTAGCGGTGCAGAAGTTGCTT
AGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTGAAGGTTTAAAACAAAATGTCTTCCTTCAG
ACAAATGTACTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCACAGGTTCAGGCCTTAGACTCACATCTTTAATCC
ACTTTCATTTGATTTTTGTGTATGGTGACAGGTAGAGGTGCAGTTTCATTCCTCTGCATGTAGATGTCCAGGTTTCCCTG
CACTGTTTATTGAAAAAACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCTTTGTCAAAGTCCATTGGATGGGCTGGGCA
TGGTGGCTAACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGCTGGTGGATCACCTGAGGACAGGAGTACAAGATTACT
CTGGCCGACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTGAGCATGGTGGTCAGCACCTGTAATACTAC
TACTCAGGAGTTTGAGGCAAGAGAATTGATTGAACCCAGGAGGCTGAGGTTGCAGTGAACCGAGATTGCACCTCTGCACT
CCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAAATAAAAAAAATTGGATGTAAATGCATGGATTATATCTG
TGTTCTTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACATCATGCTGTTTTGCTTACTACAGCTCTGTAA
CATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTGAAGTCTCAAGACAGTGGGCGTCACATACA
AAAATTATGGAAGAAAGGATCCCTGGACTCCCAGGGCCCAATGTTAGATAACAGAGTGTTGGCCATGAACCAAACTCAAA
GATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCTGTCTCATGTTCTAGGAAACCCTTCAAATAG
TTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGGACCCTCTTATATCCGCTTTTGGAACCCTGGGGAG
GTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACATTGTACGCCTGTCTTCTACCATCTCCGAACT
CCAGATACTCCAACAGCGAAAGGGATCTGGGCCCAACACAGGGCTCAGTGAAATCTCTTCATCTCTCATTTTATGGAGCT
GAGACCTCCTACAAGCTAGAAGAATGATTGCCAATCTGACATCCTTCTCAGGAAAAACGCAATGTTTGTTCTGCTTGCAT
TCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGAAGCGAACATCTGATGAGGGCGAGGTGTTTTAGAG
AAGTTCCACTTGCCAAGGAATGAGCTCCTGTTGGTCATGAAACAACCCTGGCTGACTCAGCAGAGCAAGAGCCTTGCCGT
AACAGAGAACAGAGCTCATGCACGCACACTTTGACTCACTGACTTATTCAGCCACGGCCCCATGCTCAGGTTGTGCAGTG
TGGAAGCTTTTCCTATTGTTGCCATAACAAATTTCCACAAGATTCGTGGGTGAAAACAAAACGGTTATTTAATTATCTTA
CAGTGCTCTAGCTCAAAGCATGAAGTGCATCTCACTGGGCTAAAATCAAGATGACAGCAAGCCTGCCTTCCCTCTGAGGA
TTCCAGGCAAGAATCTGCTTCTCACTTGTCCCATCTTATAAAGGCTCCCAGTTCCTTGGCTGCTGGTCCCTTTCCTCCTT
CCTCAAAACCCACAAAGACTGGTCACATCTCACATGGCATCACTCAGACCCTTCTTCCTTACCACACCTCTTTCTCTGAA
TGCTGCTCTCCCTTCTTCCTCATCTTTTGAAAACTTGGGGATTCTATTGGGTTCACCAAGATGAAAATCCGTCATAATCT
CCCGGAAATCATTCAGGATACCCTTGTTTTAAGTTCAGCTGATTAGCAACCATAATTCCATCTGCAATCTTCATTCCTCC
TTTCCATGTAAAATAACATATTCACAAGCTATGGAGGCTAGGACAGGGACATTTTGGGGTGGGACAGCATTCTCCTGCCT
TCCACAAATGGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGACACTGATATTGCAGATGGTTAAATGGGAGGACAGAA
AATGAATGCACAAGTGGACCAATAAATGAATGATCCATTGGGAAGCATCTGTGCATGAAATCTATTTGTTTGTTTGTTCG
TTTGTTTATTGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAGTGCAGTGTCACGATCTTGGCTCACTGCAACCTGCGT
CTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGCTGGGATTACAGGCAACTGCCACCATGCCCGGCTAAT
TCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCACCATGTTGGCCAAGCTTGTCTGAAACTCCCAACCTCAAGTGATCC
GACCATCTCAGCAACCCAAAGTACTGGGATTACAGGCGTGAGCCACTTTGCCCAGCCAGAATTCAAAATAAATAATAGAT
AATGCTGAGTGTATAATTTTGGGTGACAGAGAAGGTCTCACTAATCAGATATTTGTGACATTAATGAAAAACACGGATTG
AACCCCTGAAAGATTGGCGGAAGGATTTTCCACACACAGCTGTCAGCTGTGAAGGCACAAAGGTGAAAACAATCTGATGT
TGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGAGAATGACAAGATGACTGTAGAGAGATGGAGAGCACT
CTGGGTACACAGGAAACTAAGGAGGAACAAGGAGTGTGTGTTTGACACTCACAGCCATTGGATTCACCTCGGGGTAACCA
GGAATCCCTACATGATTAATAGTGACTGACAAGAAAATAAGGGAGGCCCAGGTGCGTAACTGGAATCTAGGAGACTGTGG
AAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTAGACACTAAATGAATGAAGTAGATGGATATAAGATAT
GCTTGTGAGGTAGAATCATTGGCTGGAAAGGCTTGCTGGGTTTGATTTTCCTACTTGTTTAATCCTCGCTTAATTAATTT
CTTTCTGAGATTTATTCATCCTACACATAAATCAATACCTGGCAAAGGAGTGACAGATATATGAGGGGTGGTGGAAATGA
AGGGACCTATTATAGCATAATATACAAGTCTGTGAACGGTGGCTCATGCTTGTAACCCAGCCCTGCAGGAGGCCAAGGCG
GGTGGATTCCATGAAGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAAACCCTATCTGTACTAAAAATACAAAAAT
TAGCCGAGCATGGTGGTGCATCCCTGTAATCCCAGCTCCTACTCTGGAGGATGAAGCAGGAGAATGACTTCAACCCAGGA
GGTGGAGGTTGCAGTGAGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAA
AAATAAGAAATGCATAAATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTCTATTTCT
CTATAATTACTTCTTTGATCCTTTATCTTATCCATTAGGCAATCAGCCTAAAACCTCTTCCCTATTTGGCTTTCTGTGAG
CATGAGATCACATAGAAAATGTGAAAGCCCGCTGAATCCTCCAGCACGGATCCTGGAATAGAGAAAGTGCTCTGGTCATC
GCAAAAAAAAACTTGCCCACTCACCCAAATCGCCCACCTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCA
TGGGGAGGAAACATTAATATTCCTTGGAGTGAGTCCAGATCTTGGAATCAGAGATCAGCGACAGCACTAGCTCCTGTTCC
CCTTTCCTACTAATTCACAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTC
GGGTAGAACAGCAGCCTAACATGTGTCTCCCGAGATCACAAAGAGCAGCACATTTCACACGGGCTTCAACACTATTTTCT
GGCTGTTTGACATAAGAGAATCTTGCTTCGCTATTTTTAATCGTGATTTCACCTTTGTTTCCTTTCCTTGGTGAATGCAA
TTTGTTTGACTCAAGAATGCTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTATCAATCCCAGTGCAGTCTTCCCA
GAGAAGACTCTAAACAAATCCTGGACTGCACCTGGGCCTATGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGA
ACACACAGAGGATACGTTACATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGACAACAGAAGCCTGCATTTCAAT
GTGAGCCAGTCCCTCAAGGCTCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAACTGGGGGAAGCC
AGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCA
GGAAGAACAGGAAGACAGCCCAGGCTGTTCTGAGACATTCCTCCTGATCTCAGGATGTTGCTATCTTAGTCCATTTTTGT
TGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACAGTTCTGCAGGCTGTACTG
GAAGCATGGCACCAGAATCTATTTCTCTTGACGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTG
TGCAGAGACCGCAGAGATCACACGGCAAGAGAGAGAGTAAGGGGGAGAGGGAGCGATGGAGCTTCCAAGCTCTTTTTAAC
AACCAGCTCTCCAGGAACTAACAGAGGGGGAACTTGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGA
TCCACCTCCATGACCCAAACACCTCTGAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAAG
GGTCAAACATCTCAACTAAAGTAGTTGTATCCTCAGCACGTTCTATGGTTACTATGAGAGCTATAATTGAGAAAGCAGGG
GAAAGCTAGGTCTCCCGCCATTTGGGTGCTTGTCCTAAAGAGACGTTGTATGTGGTTACCTGCCAATCAAGAAATGCGAG
ACAATTCATAAAGAGGAACTGCTATGATTAGCTTCTTATTGGTGTCTCCTCTTCTTCCAGGTAACCCCAGACACCTACAT
GTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAA
AAAAAGTAAGTCTCACGAAGCAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACGCGGATGTGTGT
TCCTCACCAGCAGGATGGTCCCTGGCCCAAGACAGGAGCCACAGAGGCAGGACTTTCTAGAGAGAGCACCAGATTCCCTT
CCCCTGCCTTCAGCTCACAGACCATTGCCTGATTCTGAACTGTATCCTCACGTCCCCTGCAGCCACTCACATCCAGGAGA
AGGTTCCATGACAGGCAGAAAGTGGGAGATAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAA
CTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGT
ATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTTCTACAGATGCTGCTGTAAT
GGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTCTTATTC
CCAAAGAGTCCTGAAAAATGTGAGCACCCTCCCTCACTCAGCATTTCCCTCTCTCCAGGATTCTGATGAACAAGACCATC
AGGAGGTGTCATACGCATAATTGGATCACTGTGTTTTCACACAGAGAAAAATCACTCGCCCTTCTGAGAGGCCCAAGACA
CCCCCAACAGATACCAGCATGTACATAGAACTTCCAAATGCTGAGCCCAGATCCAAAGTTGTCTTCTGTCCACGAGCACC
ACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCA
GCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCTTCCTCACACCACGAATCTGAACATGCCTCTCTCTTG
CTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACT
TGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACCTGAGGCTGCAATCACACTGAGGAACTCACAA
TTCCAAACATACAAGAGGCTGCCTCTTAACACAGCACTTAGACACGTGCTGTTCCACCTCCCTTCAGACTATCTTTCAGC
CTTCTGCCAGCAGTAAAACTTATAAATTTTTTAAATAATTTCAATGTAGTTTTCCCGCCTTCAAATAAACATGTCTGCCC
TCATNlib/2ds4genomiclib:2DS4_0010108GTTTGGGAGGTTGGATCTAAGACATGTTTTGAGTTGGTCATAGT
GAAGGACGCGAGGTGTCAATTCTAGTGAGAGCAATTTCCAGGAAGCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCC
TCATGCAAGGTAGAAAAAGCCTGCGTACGTCACCCTCCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAA
ATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCGCGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCAT
CATCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAATAGAGGGAGGGAGCGTGGGGATGGAGATCTGGGCCCAGAGGTGGA
GATATGGGCCTGGAGGTGGAGTTATGGGCCTGGAGTGGAGATCTGGGCCTAGAGATGGAGTGATGAGCCTAGAAGTGGAG
ATCTGCGCCTGGAGTGGAGATCTGGGCCTGGAGTGAAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGGGATAG
GAACCTGGAGTGGAGAGAGGAACCTGGAGGAGAGATAGGAACCTGGAGGGGAGGTAGGAGCCTAGGGTGGAGATATGGGA
CTGGAGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGG
AGGTGGAGATACGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATGGTCCTGGAGTGGAGATATGGGCCTGGAGT
GGAGATATGGGTCTGCAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGACTGGAGTGGA
GATATGGGACTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATCTGGGCCTGGAGTGGAGAT
CTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGATATGGGCCTGGAGGTGGAGATATG
GGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGA
CTAGAGTGGAGATAGGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTG
GAGTGGAGATATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGATATGGGCCTGGAG
TGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTAGAGTGG
AGATACGGGCCTGGAGGTGGAGATCTGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGA
TATGAGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGAGCCTGGAGTGGAGATATG
GCCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGACATATGGGTCTGGAGTGGAGATACGGGCC
TGGAGGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGTGATATGGGCCTGGAGTGTAGACATGGGCCGA
GTGGAGATATGGGTCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTGGAGTGGAGATATAGGCATGGGGTGG
AGACATGGGCCGGGAGTGGAGATATGGGACTGGAGTGGAGATACGGGCGTGGGGTGGAGATATGTGCCTGGAGGTGGAGA
TATGGGCGTGGGTTGGAGATATGGGCCTGGAGTGGAGATATGGGCGTGGGGTGGAGATATGGGTCTGGAGTGGAGACATG
GGCATGGGGTGGAGATATGGGCCTGGTGTGTAGATATGGGCCTGGAGTGGAGATATGGCCCTGGAGTGGAGATATGGGCC
TGGAGTGGAGATCTGGGCCTACGGTGGAGATATGGGCCTAGGATGGGGATATGGGCCTGGAATGGAGATATGGGCCTGGG
TGTGGAGATATGGGACTGGAGTGGAGATATGGGCCTGATGTGGAGATATGGGCTTGGAGTGGAGATATGATCCTGGAGTG
TAGTTATGGGCCTGGAGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGTGGAGATATGGGACTGGAGAGGAG
ATATGGGACTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCCTGGATTGGAGATATGGGCCGAGGGTGGAGATCT
GAGCCTGGATTGGAGATGTGGGCCCGGATTGGCTATATGGGTCTAGGGTGGAAATATCGGCCTGGAGTGGAGATATGGGC
CTGGAGTGGAGATATGGGCTTGGGGTGGGGATATGGGCCTGGAGGCTGGGTCTCTGCACAGCCGAGAGCACTGTTCTTGG
GTGCAGGTAGGCACTGATGGTGAGTTTCCCTTCGGCCCAGGAAGGGGCTGGCTATCAAGACTCACAGCCCAGTGGGGGCA
GCAAGGAAGGCCTTGTTTGCCTGCAAATGGATCTTCCATCATGATCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCC
TGGCCACAGGAGGGTAAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGAAACGGGAGGG
AAGTCCTGTCAGGGAGTCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCCACAGTTCCGACCTTGCCTCCC
TGGCCTCTCAACCCCTTGGCAGAGTCAAGTTGTGTGGGGACCAGGGTTGGACTAGGGTGTTCAAAGCTGGGTTGTGTGGT
GGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACACTTCAGCGTTTCCATGACGGTAGGGGC
TGCAGTGTGGCTGCTGTCATTCTACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACATTCCAAATCCTCTGATGGG
GGCTAAGTTTTTTATTTTCATTCAGGCAACTGCTGATATTCCATTCTCAAAGGACATGCCCTCCACTTCATGTCTACCCT
GTGTTGTTTTATGTCAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCACTTGCTCAAAGTTCTCAGC
TGACACTTTTGTTGTACGGAGACACCTTGTCTTTGTGGGATGGGTCCTTCCTTTAGCCCTAGGCACCAAGGTGTGATAGC
AGCCATAGAAATGTGGAAAGTGGGGAGAATCTTCTGAGCACAGGGAGGGAGGCACAGCTCCACATCCTCCTCTCTAAGGC
GGCGCCTCCTTCACCCCAAGGTGGTCAGGACAAGCCCTTGCTTTCTACCTGGCCCAGCCTTGTGGTGCCTCCAGAACATG
TGACTCTTCAGTGTCACTCTAATCTTGGGTTTAACAACTTCAGTCTGTACAAGGATGATGGGGTGCCTGTCCCTGAGCTG
TACAACAGAATATTCTGGAAAAGCCTTTTCATGGGCCCTGTGACCCCGTCACATGCAGGGACCTATAGATGCCGGGGTTC
ACACACACACTCCCCCAGTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCT
GGGATTCTCCTTGTCCCACCTCCTGAATCCCAGAGCTTCTGGTAGGCATGTCCTTGAGGGTCCCATCACGCAGGCCCTAA
CTGTATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAAGTGTCCCCAGTGATGACTG
CATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGGACTGAAGGGGAAGATGGAGCTCAGGTTGTTGAT
GAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGGTGGGCTCAGTATAATCACAAGTGTCCACATGAAAGGAGG
AGGAAGAGGAGAGTGGGGATTAGAGCAGCGTAGTGGGAGACTCCATCAGCTTTGAAGGTGGATGAAGGCCATAAGCCATG
AATGCAGGTGGCCTATAGAGGCTGGGAAAGTCAAGTAACTGATTCTCCTGAGTCTCCAGAGGGAACACAGCCCTGCAGAT
GCCTTGATTTTAGCCCTCGAAAAACAGGGTCCGCTTTCTGTCTCCAGAATCGGAGGGGGTCAGTGTGCTCTCTCCTGCTG
CCATGCTTCTGATAATTTTCTAAAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGACAAGTTAAGAAAAGACA
CAAGGATAGCCAGGCATGGTGGCAGGTGCATGTAATCCTAGCGACTCGGGAGGCTGAGAGCAGGAGAATCGCTTGAACCC
AGGAGACAGAGGTTGCAGTGAGCGTAGACCACACCACTTCACTCCAGCCTGGGTGAAGGAGTGAGACTCTGTCTCCAAAA
TTAATTAATTAATTAAAGAAACCAAACAAAGAGAAGGTTGGCTACACCGAGATCAGCAAGGGTGGGATGATGATGCCACC
ACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAATCAGCACGAGGAGCCAGCCTATGGAAACTGGCACCATG
GAGAAGGCACAGACATGGCAAGAGTGGCTCCCAGTCCCCACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTG
ATCAGTTCATACCTCCTGCCAAGGATTCCAATTCGTCCAAAAGAGATTGAACCAGGCTGCTAAGAGCCGGGACGTGCAGC
CTATCCTGCTTCCTCTTCCACTCCCACATAGACAGTAAGAAAGACATTAGTGTGAAATAGATACAACAGCCCAAGAGATG
AGGCTGAGCCCAGTGGGAAGGGAATCACAGCTACTAGAGACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGAC
CTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGCAGAGAGACAGACACCAGCGAAGGGAAG
GCTCACTCATTCCAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAACCTCTCTTCCTAGGAGTCC
ACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCGGAT
GTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTTGCACCTCATTGGAGAGCACCATGATGG
GGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCCTTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTC
ACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATGGTGATCATAGGTGAGAGTGTCCAGACATTCTTCTCA
TTGTCATTGGGATGCAGAGTGAATGATCCAGGACTTGGAGACCCAGGTGGTTGTAAGGAAGATGAGCTTGGTATTCTTAT
GGAGAGAGACTGACTTGGTGAGGTCTGTGCCAACAGAGACAGAGAAACAAGAGACACAAGTACAGACCAGGTGTCATAAC
AGAGGACAAACACAGGGGCCATACAGGGAGTTAGAAAAGACAGAAAGAGTTAAAGGAGACAGACAGACATGTCCCAGACA
GAGGTGTCCTTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTG
TTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGGCCTCAGGCCTTGTGGCACCTAC
AGATGCCATGCTTATTCTGACACCTCTGACTTCCATGCAATGGAGAATAATCGTCCCAAAATATCATGGCCCCAGAACAC
CAACCCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATCACA
TATGAGAGGATCACTGAGAAGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACACACAGAGAAAGAGCCA
GAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAGAGGGCAGAGAAGTGGAGAGAATGATGGAAGAGAGC
AGAGAAAACCACTAAAATTAGAGTCCTGAGGGCGAGGCACAAGGGCATAGAAAGATGGAGATGTGGGGATGAATTGCAGA
GATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATACAGATAGATGATGGATAG
ATATAGATAGATGATATATAGGTAGATGATAGATAATAGGTTATAGATACATAGATGATGATTGATTGATTCATTAATAG
ATGATACATAGAGATGATGATGATGAAGATAGATGGATAGATAATACATAGAGATAGAGAGGAAGACAAAGAGAGAAATA
ATAGAGAGAGAGAGATGATACATATATATAGATAATAGATGATTGACGGATAGACAATTGATAGATAAATAGATGATATA
TAGATATAGATGACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATGGATTGATAGATAATAGATAGAAA
TATGCAGAAAGTTATGAACGGGACACAAACTGAGAAACTCAGAGTTAAAAAAAGTAACATCAAGTCAACCAATCCAAGGA
GAGCCAGAGAGAATAAAACAATCCAAAAAAGGAAAACATAACTAGAGGTAGGGAAGTGAGGTCAGAGACCTACAGAGACA
GAGAAGGTGGAAGGAGGAAATAGACATGAAGAGAGATAGGGTGGAGGGTGAGACAGAGAAAGAGAGCATTAGGCCATAGA
GCAGGGGAGTGAGTTCTCAGGTCAGGTGTGAGGGGAGCTGTGACAAGGAAGATCCCCCCTGAGGAAACTGCCCCTTCTCC
TTCCAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCC
TGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCG
CAGCATCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTT
TCCGTGACGCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTGCTTGTTTCCGTCACAGGTGAGGAAACCCCATATCTG
TCCCATGTCCTATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGATGATGGAGAGAAGCATGGACAGATGCAGAGAG
AAGACGCAGCATGCCTGTGAGGGAGGGATCAGGGCGCAGGATGGCACACACAGCACCTCCAAACCCTCCTGCATGGCCTG
CATGGAGGCCTCCGATTAGGGCTCCAGAAACCCAGGCAGATGTAGAAAGCGGTCAGGAGAGACCCAGAGAAGGGGAGACT
GGGCTCAGTTTGGGGAGATCAGAGGTTCCCTCAGCCCCTCAACCTTACCCATTTCCCAGAAGCCCTTCCTGGCCTCTCAC
CCACACAGAGATGTCATCACCAGCAACCCCTACATCCTTTTCTTTTTGTTTGAAAAAATATTCATTGAGGTTAAATATAC
CTATATAGCTTACCACTTTTAACATTTTTTTTTTTTTGAGGTGGAGTCTAGCTCTGTCTCCTATGCTGGAATGCAGTGGC
ACAATCTCAGCTCACTGTAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCACCTGAGTAGCTGGTACTAC
AGGCGCCCATCACCACGCCGGGCTACTTTTTGTATATTTAGTAGAGAGGGGGTTTCACCATGTTGGTCGAGCTGCTCTGG
AACTCCTGACCACGTGATCCACCCGCCTCAGGCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCCACG
TTTACCAATTTTAAGTGTAAGGTCTAGTGGTCATAAATACATACATATAAATTTTTTGTTTGTTTGTTTTATCCTCCACC
CTTTTCTTCCTGGCCTCTGGTAGCCACCATTCTACTCTCTATCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTG
AGAAATGAGAATATTTGTAATGACTTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTATTCTTTCTATGGATGA
GTAGTCTCCGCTGTGCGTATGTACTACATTCTCTCTATCCATTCATCCACTGATGGGCAGGTAGGTTGACTCCACATCTT
GGCTACTGTGAAGAGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATACATTGATTTACTTTCCTTTGGATATA
AACCCAGTAGTGAAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGA
CAGTTTCCCTCTGTGCCCAGGCTGGAGTACAAGTGATGTGATCTTGGCTCATTGCAACCTCCGCCTCCTGGGTTCAAATG
ATTTTCCTGCCTCAGCCTCCCTAGTAGCTGGGATTACAGGTGCACGCCACCATGCCGGGATACTTTTTGGTTTTTTTTAA
GTGTACATGGGGTTTCCCCAGGTTGGCTAGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCA
AAGTGCCGGGATTACAGGCATGATCCACTTCATCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCATACTTTTCTCCGTA
ATGGCTGTACTAATTTACACTCCTACCAACAGGGTACCAGGGTTCTCCTTTCTCTACCACCTTGCCAGCATTTGTTTTGC
CTGTCTTGCAGCTAAAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGGAG
TGCAGTGGTGCGATCTCGGCTCACCGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGC
TGGAATTACAGGCACACGCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGCGTTTCTCCATGTGGGTCAGA
CTGGTCTCAAACTCCCGACCTTATGAGATTCGCCCACCTCGGGCTCTCAGAGTTCTAGGATGACAGACGTGAGCCACCTC
GCCCGGCCTAAAAGCCATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTCGCGTTTCTCTGATGATGAGTGA
TACTGAGCACTTTTTCGTATGTGGGGAAATTTCATGTCTTTTGCTCCTTTTTCAATTAAATCATTTGTTTTATTGAGTTG
TTTGAGCTTCTTATACTTCTAGTTATTAATCCCGTCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTG
TCTCTTCACTTTGTTGGTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTC
GATTACTTGTGTTTTGAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAATGTACTGGAGCATTTCCCCAATATTTTCTT
CTACGTGTTTCACAGGTTCAGGCCTTAGACTCACATCTTTAATCCACTTTCATTTGATTTTTGTGTATGGTGACAGGTAG
AGGTGCAGTTTCATTCCTCTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAAACTGTCCTTTCCTGATTG
TGAGTTCTTGGCACCTTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTAACACCAGCAACTTCAGCACTTTGGGA
GGCCAAGGCTGGTGGATCACCTGAGGACAGGAGTACAAGATTACTCTGGCCGACGTGATGAAACATCGTCTCCACTAAAA
ATATAAAAATTAGCTGAGCATGGTGGTCAGCACCTGTAATACTACTACTCAGGAGTTTGAGGCAAGAGAATTGATTGAAC
CCAGGAGGCTGAGGTTGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTCAAA
AGAAAAAATAAAAAAAATTGGATGTAAATGCATGGATTATATCTGTGTTCTTCATTCTGCTCCGTTGTTCTATGTGCCTT
TCTTCATGCCAACATCATGCTGTTTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTT
TTCTCTTTATACCTTGAAGTCTCAAGACAGTGGGCGTCACATACAAAAATTATGGAAGAAAGGATCCCTGGACTCCCAGG
GCCCAATGTTAGATAACAGAGTGTTGGCCATGAACCAAACTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTT
CCTCACCTCTCTCCTGTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCG
GTGAGTACAGGACCCTCTTATATCCGCTTTTGGAACCCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATC
TCACAGCTCTGACATTGTACGCCTGTCTTCTACCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGGCCCA
ACACAGGGCTCAGTGAAATCTCTTCATCTCTCATTTTATGGAGCTGAGACCTCCTACAAGCTAGAAGAATGATTGCCAAT
CTGACATCCTTCTCAGGAAAAACGCAATGTTTGTTCTGCTTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGA
GAGGGAAGGGAAGCGAACATCTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCAAGGAATGAGCTCCTGTTGGT
CATGAAACAACCCTGGCTGACTCAGCAGAGCAAGAGCCTTGCCGTAACAGAGAACAGAGCTCATGCACGCACACTTTGAC
TCACTGACTTATTCAGCCACGGCCCCATGCTCAGGTTGTGCAGTGTGGAAGCTTTTCCTATTGTTGCCATAACAAATTTC
CACAAGATTCGTGGGTGAAAACAAAACGGTTATTTAATTATCTTACAGTGCTCTAGCTCAAAGCATGAAGTGCATCTCAC
TGGGCTAAAATCAAGATGACAGCAAGCCTGCCTTCCCTCTGAGGATTCCAGGCAAGAATCTGCTTCTCACTTGTCCCATC
TTATAAAGGCTCCCAGTTCCTTGGCTGCTGGTCCCTTTCCTCCTTCCTCAAAACCCACAAAGACTGGTCACATCTCACAT
GGCATCACTCAGACCCTTCTTCCTTACCACACCTCTTTCTCTGAATGCTGCTCTCCCTTCTTCCTCATCTTTTGAAAACT
TGGGGATTCTATTGGGTTCACCAAGATGAAAATCCCTCATAATCTCCCGGAAATCATTCAGGATACCCTTGTTTTAAGTT
CAGCTGATTAGCAACCATAATTCCATCTGCAATCTTCATTCCTCCTTTCCATGTAAAATAACATATTCACAAGCTATGGA
GGCTAGGACAGGGACATTTTGGGGTGGGACAGCATTCTCCTGCCTTCCACAAATGGTGAACAAGATGCATTTGGCCTCTG
CTCTTGGGACACTGATATTGCAGATGGTTAAATGGGAGGACAGAAAATGAATGCACAAGTGGACCAATAAATGAATGATC
CATTGGGAAGCATCTGTGCATGAAATCTATTTGTTTGTTTGTTCGTTTGTTTATTGAGACAGAGTCTCCCTCTGTCTTCC
AGGCTACAGTGCAGTGTCACGATCTTGGCTCACTGCAACCTGCGTCTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTC
TCGAGTAGCTGGGATTACAGGCAACTGCCACCATGCCCGGCTAATTCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCA
CCATGTTGGCCAAGCTTGTCTGAAACTCCCAACCTCAAGTGATCCGACCATCTCAGCAACCCAAAGTACTGGGATTACAG
GCGTGAGCCACTTTGCCCAGCCAGAATTCAAAATAAATAATAGATAATGCTGAGTGTATAATTTTGGGTGACAGAGAAGG
TCTCACTAATCAGATATTTGTGACATTAATGAAAAACACGGATTGAACCCCTGAAAGATTGGCGGAAGGATTTTCCACAC
ACAGCTGTCAGCTGTGAAGGCACAAAGGTGAAAACAATCTGATGTTGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATG
AGGTGGGGAGAATGACAAGATGACTGTAGAGAGATGGAGAGCACTCTGGGTACACAGGAAACTAAGGAGGAACAAGGAGT
GTGTGTTTGACACTCACAGCCATTGGATTCACCTCGGGGTAACCAGGAATCCCTACATGATTAATAGTGACTGACAAGAA
AATAAGGGAGGCCCAGGTGCGTAACTGGAATCTAGGAGACTGTGGAAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGT
GCTGATTTAGACACTAAATGAATGAAGTAGATGGATATAAGATATGCTTGTGAGGTAGAATCATTGGCTGGAAAGGCTTG
CTGGGTTTGATTTTCCTACTTGTTTAATCCTCGCTTAATTAATTTCTTTCTGAGATTTATTCATCCTACACATAAATCAA
TACCTGGCAAAGGAGTGACAGATATATGAGGGGTGGTGGAAATGAAGGGACCTATTATAGCATAATATACAAGTCTGTGA
ACGGTGGCTCATGCTTGTAACCCAGCCCTGCAGGAGGCCAAGGCGGGTGGATTCCATGAAGTCAGGAGTTCCAGACCAGC
CTGGCCAACATGGTGAAACCCTATCTGTACTAAAAATACAAAAATTAGCCGAGCATGGTGGTGCATCCCTGTAATCCCAG
CTCCTACTCTGGAGGATGAAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGTTGCAGTGAGTGGAGATTGCATCACTG
CACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAAATATAATAAAACACACAC
GAATGACAAAGGCACCTGAATTCCAATCATCATTTTTCTATTTCTCTATAATTACTTCTTTGATCCTTTATCTTATCCAT
TAGGCAATGAGCCTAAAACCTCTTCCCTATTTGGCTTTCTGTGAGCATGAGATCACATAGAAAATGTGAAAGCCCGCTGA
ATCCTCCAGCACGGATCCTGGAATAGAGAAAGTGCTCTGGTCATCGCAAAAAAAAACTTGCCCCCTCACCCAAATCCCCC
ATCTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGAAACATTAATATTCCTTGGAGTGAGTC
CAGATCTTGGAATCAGAGATCAGCGACAGCACTAGCTCCTGTTCCCCTTTCCTACTAATTCACAGGAGGACAGGTGGTAT
TGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCGGGTAGAACAGCAGCCTAACATGTGTCTCCCGAGA
TCACAAAGAGCAGCACATTTCACACGGGCTTCAACACTATTTTCTGGCTGTTTGACATAAGAGAATCTTGCTTCGCTATT
TTTAATCGTGATTTCACCTTTGTTTCCTTTCCTTGGTGAATGCAATTTGTTTGACTCAAGAATGCTGTGGATGTAGAAAT
CCTAAAGCACATTCGCTGTGTATCAATCCCAGTGCAGTCTTCCCAGAGAAGACTCTAAACAAATCCTGGACTGCACCTGG
GCCTATGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGGATACGTTACATAGGCAGGTTCATT
ACTAACAGATAAGCAGCGAGTGACAACAGAAGCCTGCATTTCAATGTGAGCCAGTCCCTCAAGGCTCAGAAAAGCTGCTC
GGGACATATGGAGTCACCCCATTTGCAGTGTAACTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAG
CCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCCAGGCTGTTCTGAGA
CATTCCTCCTGATCTCAGGATGTTGCTATCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCT
AAAGAAAAGAGATTGGTTTGCCTCACAGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGAATCTATTTCTCTTGACGGC
CTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCGCAGAGATCACACGGCAAGAGAGAG
AGTAAGGGGGAGAGGGAGCGATGGAGCTTCCAAGCTCTTTTTAACAACCAGCTCTCCAGGAACTAACAGAGGGGGAACTT
GCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAACACCTCTGAAGAGGCC
CAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAAGGGTCAAACATCTCAACTAAAGTAGTTGTATCCTCA
GCACGTTCTATGGTTACTATGAGAGCTATAATTGAGAAAGCAGGGGAAAGCTAGGTCTCCCGCCATTTGGGTGCTTGTCC
TAAAGAGACGTTGTATGTGGTTACCTGCCAATCAAGAAATGCGAGACAATTCATAAAGAGGAACTGCTATGATTAGCTTC
TTATTGGTGTCTCCTCTTCTTCCAGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTT
CACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAGTAAGTCTCACGAAGCAGAGGCCAGAGAGC
TCAGGGCCATGTGGGGAAGCAGGATGGGAGCACGCGGATGTGTGTTCCTCACCAGCAGGATGGTCCCTGGCCCAAGACAG
GAGCCACAGAGGCAGGACTTTCTAGAGAGAGCACCAGATTCCCTTCCCCTGCCTTCAGCTCACAGACCATTGCCTGATTC
TGAACTGTATCCTCACGTCCCCTACAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGAAAGTGGGAGATAGAAT
CAATGGGATGGGACCTCAGAGCTATTCATGGGATGGGTCCTTGAACTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGC
AACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTC
CGAGCTCTTTTGTTGACTTCCGTCTTCTACAGATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACA
GCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTCTTATTCCCAAAGAGTCCTGAAAAATGTGAGCACCCTCCCTC
ACTCAGCATTTCCCTCTCTCCAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAATTGGATCACTGTGTT
TTCACACAGAGAAAAATCACTCGCCCTTCTGAGAGGCCCAAGACACCCCCAACAGATACCAGCATGTACATAGAACTTCC
AAATGCTGAGCCCAGATCCAAAGTTGTCTTCTGTCCACGAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACA
ACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGG
CATCGCTCTTCCTCACACCACGAATCTGAACATGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGA
GAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTA
CTTCCTAGTCTACCTGAGGCTGCAATCACACTGAGGAACTCACAATTCCAAACATACAAGAGGCTGCCTCTTAACACAGC
ACTTAGACACGTGCTGTTCCACCTCCCTTCAGACTATCTTTCAGCCTTCTGCCAGCAGTAAAACTTATAAATTTTTTAAA
TAATTTCAATGTAGTTTTCCCGCCTTCAAATAAACATGTCTGCCCTCATNlib/2ds4genomiclib:2DS4_001010
9GTTTGGGAGGTTGGATCTAAGACATGTTTTGAGTTGGTCATAGTGAAGGACGCGAGGTGTCAATTCTAGTGAGAGCAAT
TTCCAGGAAGCCATGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAAAAAGCCTGCGTACGTCACCC
TCCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGTGCTGCTGAGCTGAGCTGGGGC
GCGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAA
TAGAGGGAGGGAGCGTGGGGATGGAGATCTGGGCCCAGAGGTGGAGATATGGGCCTGGAGGTGGAGTTATGGGCCTGGAG
TGGAGATCTGGGCCTAGAGATGGAGTGATGAGCCTAGAAGTGGAGATCTGCGCCTGGAGTGGAGATCTGGGCCTGGAGTG
AAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGTGGGGATAGGAACCTGGAGTGGAGAGAGGAACCTGGAGGAGAGA
TAGGAACCTGGAGGGGAGGTAGGAGCCTAGGGTGGAGATATGGGACTGGAGTGGAGATATGGGACTGGAGTGGAGATATG
GGCCTGGAGTGGAGTTATGGGCCTGGAGTGAAGTTATGGGCCTGGAGGTGGAGATACGGGCCTGGAGTGGAGATATGAGC
CTGGAGTGGAGATATGGTCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGTCTGCAGTGGAGTTATGGGCCTGG
AGTGAAGTTATGGGCCTGGATTGGAGATATGGGCCGAGGGTGGAGATCTGAGCCTGGATTGGAGATGTGGGCCCGGATTG
GCTATATGGGTCTAGGGTGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATATGGGCTTGGGGTGGGGA
TATGGGCCTGGAGGCTGGGTCTCTGTACAGCCGAGAGCACTGTTCTTGGGTGCAGGTAGGCACTGATGGTGAGTTTACCT
TCGGCCCAGGAAGGGGCTGGCTATCAAGACTCACAGCCCAGTGGGGGCAGCAAGGAAGGCCTTGTTTGCCTGCAAATGGA
TCTTCCATCATGATCTTTCTTTCCAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGGGTAAGTCCTTCTCCAAAC
CTTAGGGTGTCATCTCCCCACATAAGAGGATTTTCCTGAAACGGGAGGGAAGTCCTGTCAGGGAGTCTCTCATAAACTAG
GAAGAGGGGACCCTGGGGTGCTCGGCCCACAGTTCCGACCTTGCCTCCCTGGCCTCTCAACCCCTTGGCAGAGTCAAGTT
GTGTGGGGACCAGGGTTGGACTAGGGTGTTCAAAGCTGGGTTGTGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGA
GGACAAAGGTGTTACTCACACACTTCAGCGTTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCATTCTACCAGAAG
AGGTGGGAAACCACAGCCATGGCCCTGACATTCCAAATCCTCTGATGGGGGCTAAGTTTTTTATTTTCATTCAGGCAACT
GCTGATATTCCATTCTCAAAGGACATGCCCTCCACTTCATGTCTACCCTGTGTTGTTTTATGTCAGTAATCTTACAGTAT
TAAAATCTAGTAGGAGTCTCTTACTCAGCACTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTACGGAGACACCTTGTC
TTTGTGGGATGGGTCCTTCCTTTAGCCCTAGGCACCAAGGTGTGATAGCAGCCATAGAAATGTGGAAAGTGGGGAGAATC
TTCTGAGCACAGGGAGGGAGGCACAGCTCCACATCCTCCTCTCTAAGGCGGCGCCTCCTTCACCCCAAGGTGGTCAGGAC
AAGCCCTTGCTTTCTACCTGGCCCAGCCTTGTGGTGCCTCCAGAACATGTGACTCTTCAGTGTCACTCTAATCTTGGGTT
TAACAACTTCAGTCTGTACAAGGATGATGGGGTGCCTGTCCCTGAGCTGTACAACAGAATATTCTGGAAAAGCCTTTTCA
TGGGCCCTGTGACCCCGTCACATGCAGGGACCTATAGATGCCGGGGTTCACACACACACTCCCCCAGTGGGTGGTCGGCA
CCCAGCAACCCCCTGGTGATCATGGTCACAGGTCAGAGGGCTCCTGTCTGGGATTCTCCTTGTCCCACCTCCTGAATCCC
AGAGCTTCTGGTAGGCATGTCCTTGAGGGTCCCATCACGCAGGCCCTAACTGTATTTGGGGTAAAGGGGGATTGAATACA
GGGAAATGGGTGCTGTGGTGGGAAGAATAAGTGTCCCCAGTGATGACTGCATTCTAATCCCTGGAGTCTGTGACTATTTA
TGTTATAGGGGAAGGGACTGAAGGGGAAGATGGAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGG
ACTGTCCCGGTGGGCTCAATATAATCACAAGTGTCCACATGAAAGGAGGAGGAAGAGGAGAGTGGGGATTAGAGCAGCGT
AGTGGGAGACTCCATTAGCTTTGAAGGTGGATGAAGGCCATAAGCCATGAATGCAGGTGGCCTATAGAGGCTGGGAAAGT
CAAGTAACTGATTCTCCTGAGTCTCCAGAGGGAACACAGCCCTGCAGATGCCTTGATTTTAGCCCTCGAAAAACAGGGTC
CGCTTTCTGTCTCCAGAATCGGAGGGGGTCAGTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAA
CAGGAAACCAACACTGGAACCCAGGTCAAGGACAAGTTAAGAAAAGACACAAGGATAGCCAGGCATGGTGGCAGGTGCAT
GTAATCCTAGCGACTCGGGAGGCTGAGAGCAGGAGAATCGCTTGAACCCAGGAGACAGAGGTTGCAGTGAGCGTAGACCA
CACCACTTCACTCCAGCCTGGGTGAAGGAGTGAGACTCTGTCTCCAAAATTAATTAATTAATTAAAGAAACCAAACAAAG
AGAAGGTTGGCTACACCGAGATCAGCAAGGGTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGA
TACTCCTCAAATCAGCACGAGGAGCCAGCCTATGGAAACTGGCACCATGGAGAAGGCACAGACATGGCAAGAGTGGCTCC
CAGTCCCCACCAGGAACAGGGTGTGTGGACACTGGTGCCTGCCTTACTGATCAGTTCATACCTCCTGCCAAGGATTCCAA
TTCGTCCAAAAGAGATTGAACCAGGCTGCTAAGAGCCGGGACGTGCAGCCTATCCTGCTTCCTCTTCCACTCCCACATAG
ACAGTAAGAAAGACATTAGTGTGAAATAGATACAACAGCCCAAGAGATGAGGCTGAGCCCAGTGGGAAGGGAATCACAGC
TACTAGAGACAGAGGGACAGAGAAGAGGGAGGGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAA
CATGAAGACACAGAGAGGAAGCAGAGAGACAGACACCAGCGAAGGGAAGTCTCACTCATTCCAGGTGCCATGGATGGGAT
GATAAAGAGAGACACCTTCTAAACTCACAACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGG
TCACCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAG
AGGGGAAGTTTAACAACACTTTGCACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCC
ATGATGCCTGTCCTTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGA
CCCTCTGGACATGGTGATCATAGGTGAGAGTGTCCAGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCAG
GACTTGGAGACCCAGGTGGTTGTAAGGAAGATGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTGCC
AACAGAGACAGAGAAACAAGAGACACAAGTACAGACCAGGTGTCATAACAGAGGACAAACACAGGGGCCATACCGGGAGT
TAGAAAAGACAGAAAGAGTTAAAGGAGACAGACAGACATGTCCCAGACAGAGGTGTCCTTCCATGCTGACTTTGCTCAGA
GACCTGGCACAGGTTAGAAGTTTCATTTCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCAT
ATTTCTGACCTGAGTTGGGCCCTGTGGCCTCAGGCCTTGTGGCACCTACAGATGCCATGCTTATTCTGACACCTCTGACT
TCCATGCAATGGAGAATAATCGTCCCAAAATATCATGGCCCCAGAACACCAACCCCTGTATGCTGTGTGAACTTGTGGTC
TCCAGACTGGATTCTGAGGCTCACATTCCAAATAACCCCACATATCACATATGAGAGGATCACTGAGAAGCACAGAGAGA
AATCAGGGACACCAAAAAGCAAAGACATAAACACACAGAGAAAGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACA
TAAAGAGAGAGAAGAGGGCAGAGAAGTGGAGAGAATGATGGAAGAGAGCAGAGAAAACCACTAAAATTAGAGTCCTGAGG
GCGAGGCACAAGGGCATAGAAAGATGGAGATGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGG
CAGAGCAAGACAGATGATAGATGGATAGATACAGATAGATGATGGATAGATATAGATAGATGATATATAGGTAGATGATA
GATAATAGGTTATAGATACATAGATGATGATTGATTGATTCATTAATAGATGATACATAGAGATGATGATGATGAAGATA
GATGGATAGATAATACATAGAGATAGAGAGGAAGACAAAGAGAGAAATAATAGAGAGAGAGAGATGATACATATATATAG
ATAATAGATGATTGACGGATAGACAATTGATAGATAAATAGATGATATATAGATATAGATGACAGGTAGAGAATTTGTAG
ATAGGCACCGAATAGATAAATAGATGGATTGATAGATAATAGATAGAAATATGCAGAAAGTTATGAACGGGACACAAACT
GAGAAACTCAGAGTTAAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGCCAGAGAGAATAAAACAATCCAAAAAAG
GAAAACATAACTAGAGGTAGGGAAGTGAGGTCAGAGACCTACAGAGACAGAGAAGGTGGAAGGAGGAAATAGACATGAAG
AGAGATAGGGTGGAGGGTGAGACAGAGAAAGAGAGCATTAGGCCATAGAGCAGGGGAGTGAGTTCTCAGGTCAGGTGTGA
GGGGAGCTGTGACAAGGAAGATCCCCCCTGAGGAAACTGCCCCTTCTCCTTCCAGGTCTATATGAGAAACCTTCTCTCTC
AGCCCAGCCGGGCCCCACGGTTCAGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACC
ATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCAACGGAACATTCCAGGCCGACTTT
CCTCTGGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTACGAGTGGTCAAACTC
GAGTGATCCACTGCTTGTTTCCGTCACAGGTGAGGAAACCCCATATCTGTCCCATGTCCTATGATCCTAGAGCCTTAGCT
GAGGAGCTTCCTGCTGATGATGGAGAGAAGCATGGACAGATGCAGAGAGAAGACGCAGCATGCCTGTGAGGGAGGGATCA
GGGCGCAGGATGGCACACACAGCACCTCCAAACCCTCCTGCATGGCCTGCATGGAGGCCTCCGATTAGGGCTCCAGAAAC
CCAGGCAGATGTAGAAAGCGGTCAGGAGAGACCCAGAGAAGGGGAGACTGGGCTCAGTTTGGGGAGATCAGAGGTTCCCT
CAGCCCCTCAACCTTACCCATTTCCCAGAAGCCCTTCCTGGCCTCTCACCCACACAGAGATGTCATCACCAGCAACCCCT
ACATCCTTTTCTTTTTGTTTGAAAAAATATTCATTGAGGTTAAATATACCTATATAGCTTACCACTTTTAACATTTTTTT
TTTTTTGAGGTGGAGTCTAGCTCTGTCTCCTATGCTGGAATGCAGTGGCACAATCTCAGCTCACTGTAACCTCCGCCTCC
TGGGTTCAAGCGATTCTCCTGCCTCAGCCACCTGAGTAGCTGGTACTACAGGCGCCCATCACCACGCCGGGCTACTTTTT
GTATATTTAGTAGAGAGGGGGTTTCACCATGTTGGTCGAGCTGCTCTGGAACTCCTGACCACGTGATCCACCCGCCTCAG
GCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCGCCCGGCCACGTTTACCAATTTTAAGTGTAAGGTCTAGTGGT
CATAAATACATACATATAAATTTTTTGTTTGTTTGTTTTATCCTCCACCCTTTTCTTCCTGGCCTCTGGTAGCCACCATT
CTACTCTCTATCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTGAGAAATGAGAATATTTGTAATGACTTCCAGT
TCCATCCATGTGGCTGCAAATATCAGGATGTTATTCTTTCTATGGATGAGTAGTCTCCGCTGTGCGTATGTACTACATTC
TCTCTATCCATTCATCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTGAAGAGTGCTGCACCAATCATA
CGAGTGCAGATATCACTTCGATACATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGAAATTGCTGGATACTATGA
AAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTGTGCCCAGGCTGGAGTACA
AGTGATGTGATCTTGGCTCATTGCAACCTCCGCCTCCTGGGTTCAAATGATTTTCCTGCCTCAGCCTCCCTAGTAGCTGG
GATTACAGGTGCACGCCACCATGCCGGGATACTTTTTGGTTTTTTTTAGTGTACATGGGGTTTCCCCAGGTTGGCTAGGC
TGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTACAGGCATGATCCACTTCA
TCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCATACTTTTCTCCGTAATGGCTGTACTAATTTACACTCCTACCAACAG
GGTACCAGGGTTCTCCTTTCTCTACCACCTTGCCAGCATTTGTTTTGCCTGTCTTGCAGCTAAAAGCCATTTTATTTTAT
TTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACCGCAACCT
CCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACACACCACCACGCCCGAC
TAATTTTTGTATTTTTAGTAGAGACAGCGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCCCGACCTTATGAGATTCG
CCCACCTCGGGCTCTCAGAGTTCTAGGATGACAGACGTGAGCCACCTCGCCCGGCCTAAAAGCCATTTTAATGGGGTGAG
ATGAAAACTCACTTTGATTTTAATTCGCGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTCGTATGTGGGGAAATTT
CATGTCTTTTGCTCCTTTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATACTTCTAGTTATTAATCC
CGTCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTGGTTTATTTTTAGCGGT
GCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTGAAGGTTTAAAACAAAA
TGTCTTCCTTCAGACAAATGTACTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCACAGGTTCAGGCCTTAGACTC
ACATCTTTAATCCACTTTCATTTGATTTTTGTGTATGGTGACAGGTAGAGGTGCAGTTTCATTCCTCTGCATGTAGATGT
CCAGGTTTCCCTGCACTGTTTATTGAAAAAACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCTTTGTCAAAGTCCATTG
GATGGGCTGGGCATGGTGGCTAACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGCTGGTGGATCACCTGAGGACAGGA
GTACAAGATTACTCTGGCCGACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTGAGCATGGTGGTCAGCA
CCTGTAATACTACTACTCAGGAGTTTGAGGCAAGAGAATTGATTGAACCCAGGAGGCTGAGGTTGCAGTGAACCGAGATT
GCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAAATAAAAAAAATTGGATGTAAATGCA
TGGATTATATCTGTGTTCTTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACATCATGCTGTTTTGCTTAC
TACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTGAAGTCTCAAGACAGTG
GGCGTCACATACAAAAATTATGGAAGAAAGGATCCCTGGACTCCCAGGGCCCAATGTTAGATAACAGAGTGTTGGCCATG
AACCAAACTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCTGTCTCATGTTCTAGGAA
ACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGGACCCTCTTATATCCGCTTTTG
GAACCCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACATTGTACGCCTGTCTTCTA
CCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGGCCCAACACAGGGCTCAGTGAAATCTCTTCATCTCTC
ATTTTATGGAGCTGAGACCTCCTACAAGCTAGAAGAATGATTGCCAATCTGACATCCTTCTCAGGAAAAACGCAATGTTT
GTTCTGCTTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGAAGCGAACATCTGATGAGGGCG
AGGTGTTTTAGAGAAGTTCCACTTGCCAAGGAATGAGCTCCTGTTGGTCATGAAACAACCCTGGCTGACTCAGCAGAGCA
AGAGCCTTGCCGTAACAGAGAACAGAGCTCATGCACGCACACTTTGACTCACTGACTTATTCAGCCACGGCCCCATGCTC
AGGTTGTGCAGTGTGGAAGCTTTTCCTATTGTTGCCATAACAAATTTCCACAAGATTCGTGGGTGAAAACAAAACGGTTA
TTTAATTATCTTACAGTGCTCTAGCTCAAAGCATGAAGTGCATCTCACTGGGCTAAAATCAAGATGACAGCAAGCCTGCC
TTCCCTCTGAGGATTCCAGGCAAGAATCTGCTTCTCACTTGTCCCATCTTATAAAGGCTCCCAGTTCCTTGGCTGCTGGT
CCCTTTCCTCCTTCCTCAAAACCCACAAAGACTGGTCACATCTCACATGGCATCACTCAGACCCTTCTTCCTTACCACAC
CTCTTTCTCTGAATGCTGCTCTCCCTTCTTCCTCATCTTTTGAAAACTTGGGGATTCTATTGGGTTCACCAAGATGAAAA
TCCGTCATAATCTCCCGGAAATCATTCAGGATACCCTTGTTTTAAGTTCAGCTGATTAGCAACCATAATTCCATCTGCAA
TCTTCATTCCTCCTTTCCATGTAAAATAACATATTCACAAGCTATGGAGGCTAGGACAGGGACATTTTGGGGTGGGACAG
CATTCTCCTGCCTTCCACAAATGGTGAACAAGATGCATTTGGCCTCTGCTCTTGGGACACTGATATTGCAGATGGTTAAA
TGGGAGGACAGAAAATGAATGCACAAGTGGACCAATAAATGAATGATCCATTGGGAAGCATCTGTGCATGAAATCTATTT
GTTTGTTTGTTCGTTTGTTTATTGAGACAGAGTCTCCCTCTGTCTTCCAGGCTACAGTGCAGTGTCACGATCTTGGCTCA
CTGCAACCTGCGTCTCCTGGATCCAAGTGATTCTCCTGCCTCACCCTCTCGAGTAGCTGGGATTACAGGCAACTGCCACC
ATGCCCGGCTAATTCTTTTTGTATATTTTTTGTAGAGAGGATGTTTCACCATGTTGGCCAAGCTTGTCTGAAACTCCCAA
CCTCAAGTGATCCGACCATCTCAGCAACCCAAAGTACTGGGATTACAGGCGTGAGCCACTTTGCCCAGCCAGAATTCAAA
ATAAATAATAGATAATGCTGAGTGTATAATTTTGGGTGACAGAGAAGGTCTCACTAATCAGATATTTGTGACATTAATGA
AAAACACGGATTGAACCCCTGAAAGATTGGCGGAAGGATTTTCCACACACAGCTGTCAGCTGTGAAGGCACAAAGGTGAA
AACAATCTGATGTTGAAGGAAGAGGCTCTGCCTGAAATGCTGGGAATGAGGTGGGGAGAATGACAAGATGACTGTAGAGA
GATGGAGAGCACTCTGGGTACACAGGAAACTAAGGAGGAACAAGGAGTGTGTGTTTGACACTCACAGCCATTGGATTCAC
CTCGGGGTAACCAGGAATCCCTACATGATTAATAGTGACTGACAAGAAAATAAGGGAGGCCCAGGTGCGTAACTGGAATC
TAGGAGACTGTGGAAAAGGCAATTGCCGCCCCACTGGTGAAATGTGGTGCTGATTTAGACACTAAATGAATGAAGTAGAT
GGATATAAGATATGCTTGTGAGGTAGAATCATTGGCTGGAAAGGCTTGCTGGGTTTGATTTTCCTACTTGTTTAATCCTC
GCTTAATTAATTTCTTTCTGAGATTTATTCATCCTACACATAAATCAATACCTGGCAAAGGAGTGACAGATATATGAGGG
GTGGTGGAAATGAAGGGACCTATTATAGCATAATATACAAGTCTGTGAACGGTGGCTCATGCTTGTAACCCAGCCCTGCA
GGAGGCCAAGGCGGGTGGATTCCATGAAGTCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAAACCCTATCTGTACTA
AAAATACAAAAATTAGCCGAGCATGGTGGTGCATCCCTGTAATCCCAGCTCCTACTCTGGAGGATGAAGCAGGAGAATGA
CTTCAACCCAGGAGGTGGAGGTTGCAGTGAGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCG
TCTCAAAAAATAAAAATAAGAAATGCATAAATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCA
TTTTTCTATTTCTCTATAATTACTTCTTTGATCCTTTATCTTATCCATTAGGCAATCAGCCTAAAACCTCTTCCCTATTT
GGCTTTCTGTGAGCATGAGATCACATAGAAAATGTGAAAGCCCGCTGAATCCTCCAGCACGGATCCTGGAATAGAGAAAG
TGCTCTGGTCATCGCAAAAAAAAACTTGCCCACTCACCCAAATCGCCCACCTCACCCCTACTTCCAATCACCTGTGGAGA
TTCAGATAGACCATGGGGAGGAAACATTAATATTCCTTGGAGTGAGTCCAGATCTTGGAATCAGAGATCAGCGACAGCAC
TAGCTCCTGTTCCCCTTTCCTACTAATTCACAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTT
CCCCCAGCCTCTCGGGTAGAACAGCAGCCTAACATGTGTCTCCCGAGATCACAAAGAGCAGCACATTTCACACGGGCTTC
AACACTATTTTCTGGCTGTTTGACATAAGAGAATCTTGCTTCGCTATTTTTAATCGTGATTTCACCTTTGTTTCCTTTCC
TTGGTGAATGCAATTTGTTTGACTCAAGAATGCTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTATCAATCCCAG
TGCAGTCTTCCCAGAGAAGACTCTAAACAAATCCTGGACTGCACCTGGGCCTATGCCAATTCCTATCACTCACCGTCACT
CCAGGGAGACAGAACACACAGAGGATACGTTACATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGACAACAGAAG
CCTGCATTTCAATGTGAGCCAGTCCCTCAAGGCTCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTA
ACTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATG
ACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCCAGGCTGTTCTGAGACATTCCTCCTGATCTCAGGATGTTGCTATCTT
AGTCCATTTTTGTTGCTCTAAAGGAACACTTGAGCCTGGGTAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACAGTTCT
GCAGGCTGTACTGGAAGCATGGCACCAGAATCTATTTCTCTTGACGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAG
GAGGGTCTGTCTGTGCAGAGACCGCAGAGATCACACGGCAAGAGAGAGAGTAAGGGGGAGAGGGAGCGATGGAGCTTCCA
AGCTCTTTTTAACAACCAGCTCTCCAGGAACTAACAGAGGGGGAACTTGCTAACCCCGTCTCCTTGGGACAGCATTGATC
TGTTCATGATGGATCCACCTCCATGACCCAAACACCTCTGAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATG
TGAGGTTTGAAAGGGTCAAACATCTCAACTAAAGTAGTTGTATCCTCAGCACGTTCTATGGTTACTATGAGAGCTATAAT
TGAGAAAGCAGGGGAAAGCTAGGTCTCCCGCCATTTGGGTGCTTGTCCTAAAGAGACGTTGTATGTGGTTACCTGCCAAT
CAAGAAATGCGAGACAATTCATAAAGAGGAACTGCTATGATTAGCTTCTTATTGGTGTCTCCTCTTCTTCCAGGTAACCC
CAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCT
GGTGCTCCGACAAAAAAAGTAAGTCTCACGAAGCAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCA
CGCGGATGTGTGTTCCTCACCAGCAGGATGGTCCCTGGCCCAAGACAGGAGCCACAGAGGCAGGACTTTCTAGAGAGAGC
ACCAGATTCCCTTCCCCTGCCTTCAGCTCACAGACCATTGCCTGATTCTGAACTGTATCCTCACGTCCCCTGCAGCCACT
CACATCCAGGAGAAGGTTCCATGACAGGCAGAAAGTGGGAGATAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGG
ATGGGTCCTTGAACTCAGAGAGATAGAATGTCTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCC
CCTGTTTGTTGGTATCTGCTTATGAAATGAGGACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTTCTACAG
ATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTG
GCTAGTCTTATTCCCAAAGAGTCCTGAAAAATGTGAGCACCCTCCCTCACTCAGCATTTCCCTCTCTCCAGGATTCTGAT
GAACAAGACCATCAGGAGGTGTCATACGCATAATTGGATCACTGTGTTTTCACACAGAGAAAAATCACTCGCCCTTCTGA
GAGGCCCAAGACACCCCCAACAGATACCAGCATGTACATAGAACTTCCAAATGCTGAGCCCAGATCCAAAGTTGTCTTCT
GTCCACGAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTC
CCATGTACCAGCAGCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCTTCCTCACACCACGAATCTGAACA
TGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAAT
TCTCCATTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACCTGAGGCTGCAATCACACT
GAGGAACTCACAATTCCAAACATACAAGAGGCTGCCTCTTAACACAGCACTTAGACACGTGCTGTTCCACCTCCCTTCAG
ACTATCTTTCAGCCTTCTGCCAGCAGTAAAACTTATAAATTTTTTAAATAATTTCAATGTAGTTTTCCCGCCTTCAAATA
AACATGTCTGCCCTCAT

IPD-KIR