Allele Report for 2DP1*006


2DP1*006
Previous Designations & Local Names: FH08_BA2X
IPD Acc No: KIR00475
Assigned: 28-AUG-2009 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182343  
Cells Sequence Derived From: FH08  
Known Ethnic Origin Of Source: Black
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (1331 bps)
ATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGT
TTAACAACTTCAGTCTGTAAAAGGAAGATGGGGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTC
ATGGGCCCTGTGACCCCAGCACACACAGGGACGTACAGATGTCGGGGTTCACACCCACACTCCCCCAGTGGGTGGTCGGC
ACCCAGCAACCCCCTGGTGATCATGGCCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGA
AATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTGAGCACTTCCTTCTGCACAGAGAGGGGACATTT
AACGACACTTTGCACCTCACTGGAGAGCACCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGA
CCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACAT
CGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCT
TGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCA
GGGCCCAAGGTCAACGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGG
CTCTTTCCGTGACTCTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATA
GTTGGCCTTCACCCACTGAACCAAGCTCCGAAACCGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTGGTC
ATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAATGCTGCTGTAATGGACCA
AGAGCCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGTTGG
ATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTGTAC
ACGGAACTTCCAAATGCTGAGTCCAGATCCAACGTTGTCTCCTGCCCATGA
Genomic Sequence Data (13127 bps)
GTTCAGGAGGTTGGATCTGAGACGTGTTTTGAGTTGGTCATAGTGAAGGACGCTAGGTGTAAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCGAGCAACCACTGGGCCTCATGCAAGGTAGAAAGAGCCTGCGTACGTCACCCT
CCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAAT
AGAGGAAGGGAGTGTGGGGTTGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTGTGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTAGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGCCTGGAGTGC
CGATAGGAACCTGGAGGGGAGATAGGAGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTATAGGCCTATAGTAGAGA
TATGGGCCTGGAGTGGAGATATGGGCCAGGAGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTAGAGTGGAAATAT
GGGCCTAGGATGGAGATATGGGCCTGGTTGTGGAGATATGGGACTGGAGAGGAGATATGGGCCTAGAGTGGAGATATGGG
CTTGGGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGGTGGAGTTACGGGCCTTCAGTAGAGATATGGGCCT
GGGGTGGAGATATGGGCTTGGGGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTACTGGCCTTCA
GTAGAGATATGGGCCTGGTGTGGAGATATGGGCCTGGATTGGAGATATGGGCCTAGGGTGGAGATCTGAGCCTGGATTGG
AGATATGGGCCTGGATTGGAGATATGGGCTTACAGTGGAGATCTTGGCCTGGATTGGCGATATGGGCCTGGATTGGCGAT
ATGGGCCTATGATGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATACAGGCCTAGGGTGGAAATATTG
GCCTGGAGTGGAGATATGGGCTTGTGGTGGGGATATGGGCTTGTGGTGGGGATCTGGGCTTGGAGGCTGGGTCTCTGCAC
AGCCGACAGCCCTGTTCTTGGGTGCAGGTAGGCACTGAGGGTGAGTTTAACTTCAGCCCAGGAAGGGCCTGCCTACCAAG
ACTCACAGCCCAGTGAGGGCAGCAAGGGAGGGCTGGTTTGCCTGCAGATGGATCGTCCATCATGATCTTTCTTTCCAGGG
TTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTCGGGTGTCATCTCCCCACATAAGAG
GATTTTCCTGAAACAGGAGGGAAGTCCTGTCGGGGAGCCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCC
ACAGTTCCGACCTCGCCTCCCTGGCCTTTCATTCCCTTGGCAGAGTCAAGTTCTGTGGGGACCAGGGTTAGACTGGGGTG
CTCAAAGCTGGGGTGCGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACTTCAGCG
TTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCACTCCACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACA
TTCCAAATCCTCTGATGGGGGCTCAGTTGCTTATTTTCATTCAGGCATCGGCTGATATTCCATTCTCAAAGGACATGCCC
TCCACCCCATGTCTACCCTGTGTTGTTTTATGTGAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCA
CTTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGGGAGACACCTTGTGTTTGCGGGATGGGTCCTTCCTTTAGCCCTG
GGCACCAAGGTGTGATAGCAGCCATAGAAACTTGGAAAGCGAGGAGAATCTTCAGAGCACAGGGAGGGAGGGGTGGCTCC
ACATCCTCCTCTCTAAGGCGGTGCCTCCTTCTCCCCAAGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCTCT
GTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGTTTAACAACTTCAGTCTGTAAAAGGAAGATGG
GGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTCATGGGCCCTGTGACCCCAGCACACACAGGGA
CGTACAGATGTCGGGGTTCACACCCACACTCCCCCAGTGGGTGGTCGGCACCCAGCAACCCCCTGGTGATCATGGCCACA
GGTCAGAGGGCTCCTGTCTTGGATTCTCCTTTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGCGTGTCCTTGAGGGTC
CCATCACCCAGGCCCTGACTATATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAAT
TGTCCCCAGTGATGACTACATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGAACTGAAGGGGAAGAT
GGAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGCTGGGCTCAGTGTAATCACAAG
GGTCCACATGAAAGGAGGAGGAAGAGGGGAGTGGGGATTAGAGCAGCGCAATGGGAGACTCCACCAGCTTTGAAGGTGGA
GGAAGTCCAGGAGCCATGAATGCAGGTGGCCTGTAGAGGCTGGAAAAGTCAAGGAAATGATTCTCCAGAGTCTCCAGAGG
GAACGAAGCCCTGCAGATGCCTTGATTTTAGCCCAGGAAAAACAGGGTCCTATTTCTGTCTCCAGTAGTGAAATGGGTCA
GTGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGG
ACAAGTTAAGAAACAACACAAGGATAGCCGGGTGTGGTGGCAGGCGCATGTAATCCTAGCGACTTGGGAGGCTGAGGGCA
GGAGAATCACTTGAACCCAGGAGACAGAAGTTGCAGTGACCCTAGACCACACCACTTCACTCCAGCTGGGGTGAAGGAGT
GAGACTCTGATCTCCATAATTAATTAATTAATTAAAGGAACCAAACAAGGGGAAGGTTGGCTACACCGAGATCAGCAAGT
GTGGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCAGCACCAGGAGCCAGCC
TATGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCGACCAGGAACAGGGTGTGTGGAC
ACTGCTGCCTGCCTTATTCATCAGTTCATACCTCCTGCCAAGGATTCCAATTCATCCAAAAGAGATTGAACCAGGCTGAT
AAGAGGCTGGATGTGCAGCCTATCCTGGTTCCTCTTTCACCCCCACATAAACAGCAGGAAAGACATTAGTGTGAAATAGA
TACAACACCCCAAGAGATGAGGCTAAGCCCAGTGGGAAGGGAATCAGAGGCGACTAGAGACAGAGAGACAGAGAAGAGGG
AGGGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGA
CAGACACCAGCAAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACA
ACCTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCA
TCCTGCAATGTTGGTCAGATGTCAGGTTTGAGCACTTCCTTCTGCACAGAGAGGGGACATTTAACGACACTTTGCACCTC
ACTGGAGAGCACCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGACCTGGCAGGGACCTACAG
ATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTCATCACAGGTGAGAG
TGTCCGGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCACGACTTGGAACCCCCAGGTAGTTGTAAGGAA
GATGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAG
TACAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAGGAGTTAAAGGAGAC
AGACAGACAGACATGTCCCAGAGAGAGGTGTCCCTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCA
TTTCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGT
GGCCTCAGGCCTTGTGGCACCTACAGATGCCGTGTTTATTCTCACACCTCTGCCTTCCATGTAATGGAGAGTAACCGTCC
CAGGATATCATGGCCCCAGAACACCAACCCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACA
TTCCAAATAACCCCACATATGAAAGGATCACTGAGAGGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAAC
ACACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAAAGAGGGCAGAGGAGTGGT
GAGAATGATGGAAGGGAGCAGAGAAAAGCACTAAAATTAGAGTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGA
TGTGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGTTAGAT
ATAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTGATTCATTAATAGAT
GAGACATAGAGATGATGATGATGAAGACAGATAGATAATACATAGAGATAGAGAGGCAGACAGAAGTCATAGAGAGAGAG
ATGATACATAGATATAGATAACAGATGATTGATGGATAGATAGACAAGTGATAGATACATAGATGATATATAGATATAGA
TGACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATAGATCGACAGATAATAGATAGAAATATGCAGAAA
GTTATGAACAGGACACAAAGTGAGAAACTTAGAATTTAAAAAAGTAACATCAAGTGAACCAATCCAAGGAGAGTCAGAGA
GAATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGTGGAAGCGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGG
AAGGAGGAAATAGACATGAAGAGAGATGGGGTGGAGGGTGAGAGAGAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGGA
GTGAGTTCTCAGCTCAGGTGAAGGGAGCTGTGACAAGGAAGAGCCTCCGTAAGGAAAATGCCTCTTCTCCTTCCAGGTCT
ATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCC
GGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAAC
GGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACTC
TCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAAGCCCATGGCTGTCCCATGTCC
TATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGAGGATGGAGAGAAGGATGAACAGATGCAGAGAGAAGACGAAGC
TTGGGTGTGAGGGAGGGATCAGGGCACAGGATGGCAGACAGGGCACCTCCAAACCCTCCTACATGGCCTGCATGAAGGCC
TGCGGCCAGGACTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGAGAGACCCAGAGGAGGGAGACTGGGCTCAGTTT
GGGAAGATCAGAGGTTCCCTCAGCCCCTCAACATTACCCATTTCCCAGAAGCCCATCCTGGCCTCCCACCCACACAGGGA
TGTCATCACCTGCAACCCCTACACCGTTTACTTTTGTTTGAGAAATATTTATTGAGGATAAATATAACTATATAGCTTAC
CACCTTTAACATTTTTTTTTTTGAGGCGGAGTCTAGCTCTGTCCCCTATGCTGGAGTGCATTGGCACAATCTCAGCTCAC
TGCAACTTCCGCCTCCTGGGTTCAAGCGATTCTCTTGCCTCAGCCACCTGAGTAGCTGGTGCTACAGGCGCGCACCACCA
TGCCAGGCTACTTTTTGTATTTTTAGTAGAGAGGGGGTTTCACCATGTTGGTCAAGCTGGTCTCGAACTCCTGACCACGT
GATCCACCCGCATCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCAGCCACATTTACCATTTTTAAG
TGTAAAGTCTAGTGGTCATAAATACATTAATATATATATATATACACATATTTTTTTTTCACCCTCCACCCTTTTCTTCC
TGGCCTCTGGTAGCCACCATTCTACTCTCTACCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTAAGAAATGGGA
ATCTTTGTAATGACCTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTATTCTTTCTATGGAAGAGTAGTCTCCA
CTATGCAAATGTACCACATTCTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCACATCTTGGCTACTGTG
AAGGGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATATATTGATTTACTTTCCTTTGGATATAAACCCAGTAG
TGAAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCT
CTGTGCCAGGCTGGAGTACAAGTGATATGATCTTGGCTCATTGCAACCTCTGCCTCCTGGGTTCAAATGATTTTCCTGCC
TCAGCCTCCCTAGTATCAGGGATTATAGGCGCACGCCACCATGCCTGGCTACTTTTTGTTTTTTTTAGTATAGATGCGGT
TTCCCCATGTTGGCTGGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATT
ACAGGCCTGATCCACCTCACCCAATCTCTTTTTAGTTCTTTAAAGGACTTCCACACTTTTCTCCGTAATGGCTGTACTAA
TTTACACTCCTCCCAACAGGATACCAGGATTCTCCTTTCTCTAACACCTTGCCAGCATTTCTTTTGCCTGTCTTGCAGCT
AAAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGAGTGCAGTGGTGCGAT
CTCGGCTCACCGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCA
CACGCCACCACGCCCTACTAATTTTTGTATTTTTAGTAGAGACAGTGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTC
CCGACCTTATGAGATTCACCCACCTCAGGCTCTCAAAGTTCTAGGATGACAGACGTGAGCCACCTCACCCGGCCTAAAAG
CCATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTTGCGTTTCTCTGATGATGAGTGATACTGAGCACTTTT
TAGTATGTGGGGAAATTTCATGTCTTTTGCTCCTGTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTAT
ATTTCTAGTTATTAATCCCATCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGT
TGGTTTATTTTTAGCAGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTT
TCAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAACGTCCTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCATA
GGTTCAGGCCTTAGACTCACATCTTTAATCCATTTTCATTTGATTTTTGTGTATAGTGACAGGCAGAGGTGCAGTTTCAT
TCCTCTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAGACTGTCCTTTCCTGATTGTGAGTTCTTGGCAC
CTTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTAACACCAGCAACTTCAGCACTTTGGGAGGCCAAGGCTGGTG
GATCACCTGAGGACAGGAGTACAAGATTACTCTGGCCGACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGC
TGAGCATGGTGGTCAGCACCTGTAATACCACTACTCAGGAGTTTGAGGCCAGAGAAGTGATTGAACCCAGGAGGCTGTGG
TGGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAACAAAAAA
TACATTGGAGGTAAATGCATGGATTATATCTGTGTTATTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAAT
GTCATGCTGTCTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACC
TTGAAGTCTCAAGACAGTAGCCGTCACATACAAAAATTACGGAAAAAAGGATCCCAGGACTCCCAGGGCCCAATATTAGA
TAACAGAGTGTTGGCCATGAACCAACCTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTC
CTGTCTCGTGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCGAAACCGGTGAGTACAGAAC
CCTCTTATATCCGCTTTTGGAAACCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGAC
ATTGTACGCCTGTCTTCTACCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGACCCAAAACAGGGCTGAG
TGAAATCTCTTAATCTCTCATTTTATGGAGCTGAGATCTCCTACAAGCTAGAAAAATGATTGGCAATCTGACATCCTTCT
CAGGAAAAATGCAATGTTTGTTCTGCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGTAG
GGAACATTTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCCAGGAATGAATTACTGTTGGTCATGAAGCAACCC
TGGCTGACTCAGCAGAGCAAGAGCTTTGCCTTAACAGAGAACGGAGCTCATGCACGCACACTTCGACTCACTGACTCATT
CAGCCACGGCCCCATGCTCAGGCCGTGGAAAAGGCAATTCCCAGCACTGCAGGAGGCCAAGGCGGGTGGATCACTTGAAG
TCAGGAGTTCCAGACCAGCCTGGCCAAAATGGTGAAACCCTGTCTCTATGAACAATACAAAAATTAGTCGAGCATGGTGG
TGCATCCCTGTAATCCCAGCTCCTACTCTTGAGGATGAAGCAGGAGAATGACTTCAACCCAGGAGGTGGAGGTTGCAGTG
AGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATA
AATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTCTATTTCTCTATAATTACTTCTTT
GATCCTTTGTCTTATCCATTAGGCAATGAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGACCATATAGA
AAATGTGAAAGCCCGCTGAATCCTCCAGCACAGATCGTGGAATAGAGAAAGTGCTCTGTTCATCACAAAAAAAACTTGCC
GTCTCACTCAAATCCCCCACTTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGTAAACATTA
ATACTCCTTGGAGTGAGTCCAGATCTTGGAATGAGAGATCAGCACCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTC
ACAGGGGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCAGGTAGAACAGCAGCC
TAACATGTGTCTCCCGAGATCACAAAGAGTAGGACGTTTCACAGGGGCTTCAACACGATTTCCTGGCTGTTGGACATAAG
ATAACTCTATTTCGCTTTTTTATCTTGATTTCACTTTTGTTTCCTTTCCTTGGAGAACGCAAGTTGTTTGACTCAAGAAT
GCTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTGTCAATCCCAGTGCAGTCTTCCCAGAAAAGACCCTAAACACC
TCCTAGACTGCACCTGGGCCTACGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTT
ACATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGAAAACAGAAGCCTACATTTCAATGTGAGCCAGTCCCTCAAG
GCTCAGAAAAGCTACTCGGGACATATGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTG
GGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAG
CCCAGGCTGCTCTGGGACGTTCCTCCTGATCTCAGGACGTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTT
GAGCCTGGGCAACTTCTAAAGAAAAGAGATTGGTTTGTCTCACCGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGCAT
CTATTTCTCGTGATGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGAT
CACACGGCAAGAGAGGTAGCAAGGGGGAGGGGGAGTGATGGAGCTTCCAAGTTCTTTTGAACAACCAGCTCTCCAGGAAC
TAATAGAGGGGGAACTTGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAA
ACACCTCTCAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTA
AAGTAGTTGTATCCTCAGCACATTCTATGGTTACTTTGAGAGCTATAACTGAGAAAGCAGGAGAAAGCTGGGTCTCCCGC
CATCTGGGTGCTTGTCCTAAAGAGGTGTTTTACGTGGTTACCTGTCAATCAAGAAATGCGAGACAATTCATAAAAAGGAA
CTGCTATGATTAGCTTCTTATTGGTGTCTCATCTTCTTCCAGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCA
GTGGTCATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAGTAAGTCTTACGA
AGGAGAGGCCAGAGAGCTCCGGGCCATGTGGGGAAGCAGGATGGGAGCACTCAGGTGTGTGTTCCTCACAGGTAGGATGG
TCCCTGGCCCAAGGCAGCAGCCACAGAGGCAGGACTTTCTAGAGAGGGCACCAGACTCCCTGTCCCTGCCTTCAGCTCAC
AGACCGTTGCCTGATTCTGAACTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAG
AAAGTGGGAGACAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGT
CTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCTCCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAG
GACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTCCTACACATGCTGCTGTAATGGACCAAGAGCCTGCAGG
GAACAGAACAGCGAATAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAA
TGTGAGCACCCTCCCTCACTCAGGATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTAC
AGTTGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGA
GTGTACACGGAACTTCCAAATGCTGAGTCCAGATCCAACGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGG
GATCTTCTAGGGAGACAATAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGT
GAGTCTGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTTACAAATGTCTAAGGT
CCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCT
CCAACCTTACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAGTTCCAAACATACAAGAGG
CTCCCTCTTAACACGGCACTTAGACACGTCCTGTTCCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGAGTATCTTTCA
GCCTTCTGTCAGCAGTAAAACTTATATATTTTTTAAAATAATTTCAATGTAGTTTTCCCTCCTTCAAATAAACATGTCTG
CCCTCAT

IPD-KIR