Allele Report for 2DP1*0020108


2DP1*0020108
Previous Designations & Local Names: 2DP1_G248_Ahap_final
IPD Acc No: KIR00633
Assigned: 31-MAR-2010 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182350  
Cells Sequence Derived From: G248  
Known Ethnic Origin Of Source: Unknown
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (1331 bps)
ATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGT
TTAACAACTTCAGTCTGTAAAAGGAAGATGGGGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTC
ATGGGCCCTGTGACCCCAGCACACACAGGGACGTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGC
ACCCAGCAACACCCTGGTGATCATGGCCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGA
AATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTT
AACGACACTTTGCACCTCACTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGA
CCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACAT
CGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCT
TGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCA
GGGCCCAAGGTCAACGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGG
CTCTTTCCGTGACTCTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATA
GTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTGGTC
ATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAATGCTGCTGTAATGGACCA
AGAGCCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGTTGG
ATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTGTAC
ACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGA
Genomic Sequence Data (13126 bps)
GTTCAGGAGGTTGGATCTGAGACGTGTTTTGAGTTGGTCATAGTGAAGGACGCTAGGTGTAAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAATGAGCCTGCGTACGTCACCCT
CCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCA
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAAT
AGAGGAAGGGAGTGTGGGGTTGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTGTGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTAGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGCCTGGAGTGC
CGATAGGAACCTGGAGGGGAGATAGGAGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTATAGGCCTATAGTAGAGA
TATGGGCCTGGAGTGGAGATTTGGGCCAGGAGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTAGAGTGGAAATAT
GGGCCTAGGATGGAGATATGGGCCTGGTTGTGGAGATATGGGACTGGAGAGGAGATATGGGCCTAGAGTGGAGATATGGG
CTTGGGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGGTGGAGTTACGGGCCTTCAGTAGAGATATGGGCCT
GGGGTGGAGATATGGGCTTGGGGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTACTGGCCTTCA
GTAGAGATATGGGCCTGGTGTGGAGATATGGGCCTGGATTGGAGATATGGGCCTAGGTTGGAGATCTGAGCCTGGAGTGG
AGATATGGGCCTGGATTGGAGATATGGGCTTACAGTGGAGATCTTGGCCTGGATTGGCGATATGGGCCTGGATTGGCGAT
ATGGGCCTATGATGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATACAGGCCTAGGGTGGAAATATTG
GCCTGGAGTGGAGATATGGGCTTGTGGTGGGGATATGGGCTTGTGGTGGGGATCTGGGCTTGGAGGCTGGGTCTCTGCAC
AGCCGACAGCCCTGTTCTTGGGTGCAGGTAGGCACTGAGGGTGAGTTTAACTTCAGTCCAGGAAGGGCCTGCCTACCAAG
ACTCACAGCCCAGTGAGGGCAGCAAGGGAGGGCTGGTTTGCCTGCAGATGGATCGTCCATCATGATCTTTCTTTCCAGGG
TTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAG
GATTTTCCTGAAACAGGAGGGAAGTCCTGTCAGGGAGCCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCC
ACAGTTCCGACCTCGCCTCCCTGGCCTTTCATTCCCTTGGCAGAGTCAAGTTCTGTGGGGACCAGGGTTAGACTGGGGTG
CTCAAAGCTGGGGTGCGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACTTCAGCG
TTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCACTCCACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACA
TTCCAAATCCTCTGATGGGGGCTCAGTTGCTTATTTTCATTCAGGCATCTGCTGATATTCCATTCTCAAAGACATGCCCT
CCACCCCATGTCTACCCTGTGTTGTTTTATGTGAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCAC
TTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGGGAGACACCTTGTGTTTGCGGGATGGGTCCTTCCTTTAGCCCTGG
GCACCAAGGTGTGATAGCAGCCATAGAAACTTGGAAAGCGAGGAGAATCTTCAGAGCACAGGGAGGGAGGGGTGGCTCCA
CATCCTCCTCTCTAAGGCGGTGCCTCCTTCTCCCCAAGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTG
TGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGTTTAACAACTTCAGTCTGTAAAAGGAAGATGGG
GTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTCATGGGCCCTGTGACCCCAGCACACACAGGGAC
GTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGCACCCAGCAACACCCTGGTGATCATGGCCACAG
GTCAGAGGGCTCCTGTCTTGGATTCTCCTTTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGCGTGTCCTTGAGGGTCC
CATCACCCAGGCCCTGACTATATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAATT
GTCCCCAGTGATGACTACATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGAACTGAAGGGGAAGATG
GAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGCTGGGCTCAGTGTAATCACAAGG
GTCCACATGAAAGGAGGAGGAAGAGGGGAGTGGGGATTAGAGCAGCGCAATGGGAGACTCCACCAGCTTTGAAGGTGGAG
GAAGGCCAGGAGCCATGAATGCAGGTGGCCTGTAGAGGTTGGAAAAGTCAAGGAAATGATTCTCCAGAGTCTCCAGAGGG
AACGAAGCCCTGCAGATGCCTTGATTTTAGCCCAGGAAAAACAGGGTCCTATTTCTGTCTCCAGTAGTGAAATGGGTCAG
TGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGA
CAAGGTAAGAAACAACACAAGGATAGCCGGGTGTGGTGGCAGGCGCATGTAATCCTAGCGACTTGGGAGGCTGAGGGCAG
GAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGACCCTAGACCACACCACTTCACTCCAGCTGGGGTGAAGGAGTG
AGACTCTGTCTCCATAATTAATTAATTAATTAAAGGAACCAAACAAGGGGAAGGTTGGCTACACCGAGATGAGCAAGTGT
GGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCAGCACCAGGAGCCAGCCTA
TGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCGACCAGGAACAGGGTGTGTGGACAC
TGGTGCCTGCCTTATTCATCAGTTCATACCTACTGCCAAGGATTCCAATTCATCCAAAAGAGATTGAACCAGGCTGATAA
GAGGCTGGATGTGCAGCCTATCCTGGTTCCTCTTTCACCCCCACATAAACAGCAGGAAAGACATTAGTGTGAAATAGATA
CAACACCCCAAGAGATGAGGCTAAGCCCAGTGGGAAGGGAATCAGAGGGGACTAGAGACAGAGGGACAGAGAAGAGGGAG
GGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGACA
GACACCAGCAAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAAC
CTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATC
CTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTTAACGACACTTTGCACCTCAC
TGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGACCTGGCAGGGACCTACAGAT
GCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTCATCACAGGTGAGAGTG
TCCGGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCACGACTTGGAACCCCCAGGTAGTTGTAAGGAAGA
TGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAGTA
CAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAGGAGTTAAAGGAGACAG
ACAGACAGACATGTCCCAGAGAGAGGTGTCCCTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATT
TCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGG
CCTCAGGCCTTGTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGTAATGGAGAGTAACCGTCCCA
GGATATCATGGCCCCAGAACACCAACTCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATT
CCAAATAACCCCACATATGAAAGGATCACTGAGAGGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACAC
ACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAAAGAGGGCAGAGGAGTGGTGA
GAATGATGGAAGGGAGCAGAGAAAAGCACTAAAATTAGACTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGATG
TGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATAT
AGATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTGATTCATTAATAGATGA
GACATAGAGATGATGATGATGAAGACAGATAGATAATACATAGAGATAGAGAGGCAGACAGAAGTCATAGAGAGAGAGAT
GATACATAGATATAGATAACAGATGATTGATGGATAGATAGACAAGTGATAGATACATAGATGATATATAGATATAGATG
ACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATAGATCGATAGATAATAGATAGAAATATGCAGAAAGT
TATGAACAGGACACAAAGTGAGAAACTTAGAATTTAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGTCAGAGAGA
ATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGTGGAAGCGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGGAA
GGAGGAAATAGACATGAAGAGAGATGGGGTGGAGGGTGAGAGAGAGAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGGA
GTGAGTTCTCAGCTCAGGTGAAGGGAGCTGTGACAAGGAAGATCCTCCGTAAGGAAAATGCCTCTTCTCCTTCCAGGTCT
ATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCC
GGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAAC
GGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACTC
TCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAAGCCCATGGCTGTCCCATGTCC
TATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGAGGATGGAGAGAAGGATGAACAGATGCAGAGAGAAGACGAAGC
TTGGGTGTGAGGGAGGGATCAGGGCACAGGATGGCAGACAGGGCACCTCCAAACCCTCCTACATGGCCTGCATGAAGGCC
TGCGGCCAGGACTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGAGAGACCCAGAGGAGGGAGACTGGGCTCAGTTT
GGGAAGATCAGAGGTTCCCTCAGCCCCTCAACATTACCCATTTCCCAGAAGCCCATCCTGGCCTCCCACCCACACAGGGA
TGTCATCACCTGCAACCCCTACACCCTTTACTTTTGTTTGAGAAATATTTATTGAGGATAAATATACCTATATAGCTTAC
CACCTTTAACATTTTTTTTTTGAGGCGGAGTCTAGCTCTGTCCCCTATGCTGGAGTGCATTGGCACAATCTCAGCTCACT
GCAACTTCCGCCTCCTGGGTTCAAGCGATTCTCTTGCCTCAGCCACCTGAGTAGCTGGTGCTACAGGCGCGCACCACCAT
GCCAGGCTACTTTTTGTATTTTTAGTAGAGAGGGGGTTTCACCATGTTGGTCAAGCTGGTCTCGAACTCCTGACCACGTG
ATCCACCCGCATCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCAGCCACATTTACCATTTTTAAGT
GTAAAGTCTAGTGGTCATAAATACATTAATATATATATATATACACATATTTTTTTTTACCCTCCACCCTTTTCTTCCTG
GCCTCTGGTAGCCACCATTCTACTCTCTACCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTAAGAAATGGGAAT
CTTTGTAATGACCTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTTTTCTTTCTATGGAAGAGTAGTCTCCACT
ATGCAAATGTACCACATTCTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCTCATCTTGGCTACTGTGAA
GAGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATATATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTG
AAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCT
GTGCCCAGGCTGGAGTACAAGTGATGTCATCTTGGCTCATTGCAACCTCTGCCTCCTGGGTTCAAATGATTTTCCTGCCT
CAGCCTCCCTAGTATCAGGGATTATAGGCGCACGCCACCATGCCTGGCTACTTTTTGTTTTTTTTAGTATAGATGCGGTT
TCCCCATGTTGGCTGGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTA
CAGGCATGATCCACCTCACCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCACACTTTTCTCCGTAATGGCTGTACTAAT
TTACACTCCTACCAACAGGATACCAGGATTCTCCTTTCTCTAACACCTTGCCAGCATTTCTTTTGCCTGTCTTGCAGCTA
AAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGAGTGCAGTGGTGCGATC
TCGGCTCACCACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCAC
ACGCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGTGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCC
CGACCTTATGAGATTCACCCACCTCAGGCTCTCAAAGTTCTAGGATGACAGACGTGAGCCACCACGCCCGGCCTAAAAGC
CATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTTGTGTTTCTCTGATGATGAGTGATACTGAGCACTTTTT
CGTATGTGGGGAAATTTCATGTCTTTTGCTCCTGTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATA
TTTCTAGTTATTAATCCCATCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTT
GGTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTT
GAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAACGTCCTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCATAG
GTTCAGGCCTTAGACTCACATCTTTAATCCATTTTCATTTGATTTTTGTGTATAGTGACAGGCAGAGGTGCAGTTTCATT
CCTCTGCATGTCGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAGACTGTCCTTTCCTGATTGTGAGTTCTTGGCACC
TTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTGACACCTGCAATTTCAGCACTTTGGGAGCCCGAGGTGGGTGG
ATCACCTGAGGCCAAGAGTTCAAGATTAGTCTGGCCAACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCT
GAGCATGGTGGTCAGCACCTGTAATACCACTACTCAGGAGTTTGAGGCAAGAGAAGTGATTGAACCCAGGAGGCTGTGGT
GGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAACAAAAAAT
ACATTGGAGGTAAATGCATGGATTATATCTGTGTTATTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACG
TCATGCTGTCTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCT
TGAAGTCTCAAGACAGTAGCCGTCACATACAAAAATTACGGAAAAAAGGATCCCAGGACTCCCAGGGCCCAATATTAGAT
AACAGAGTGTTGGCCATGAACCAACCTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCC
TGTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGAACC
CTCTTATATCCGCTTTTGGAAACCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACA
TTGTACGCCTGTCTTCTACCATCTCCAAACTCCAGATACTCCAACAGCGAAAGGGATCTGGACCCAAAACAGGGCTCTGT
GAAATCTCTTAATCTCTCATTTTATGGAGCTGAGATCTCCTACAAGCTAGAAAAATGATTGGCAATCTGACATCCTTCTC
AGGAAAAATGCAATGTTTGTTCTGCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGTAGG
GAACATTTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCCAGGAATGAATTACTGTTGGTCATGAAGCAACCCT
GGCTGACTCAGCAGAGCAAGAGCTTTGCCTTAACAGAGAACGGAGCTCATGCACGCACACTTCGACTCACTGACTCATTC
AGCCACGGCCCCATGCTCAGGCCGTGGAAAAGGCAATTCCCAGCACTGCAGGAGGCCAAGGCGGGTGGATCACTTGAAGT
CAGGAGTTCCAGACCAGCCTGGCCAAAATGGTGAAACCCTGTCTCTATGAAAAATACAAAAATTAGCCGAGCATGGTGGT
GCATCCCTGTAATCCCAGCTCCTACTCTTGAGGATGAAGCAGGAGAACGACTTCAACCCAGGAGGTGGAGGTTGCAGTGA
GTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAA
ATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTGTATTTCTCTATAATTACTTCTTTG
ATCCTTTGTCTTATCCATTAGGCAATGAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGACCATATAGAA
AATGTGAAAGCCTGCTGAATCCTCCAGCACAGATCGTGGAATAGAGAAAGTGCTCTGTTCATCACAAAAAAAACTTGCCC
TCTCACTCAAATCCCCCACTTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGTAAACATTAA
TACTCCTTGGAGTGAGTCCAGATCTTGGAATGAGAGATCAGCACCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTCA
CAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCAGGTAGAACAGCAGCCT
AACATGTGTCTCCCGAGATCACAAAGAGTAGGACGTTTCACAGGGGCTTCAACACGATTTCCTGGCTGTTGGACATAAGA
TAACTCTATTTCGCTTTTTTATCTTGATTTCACTTTTGTTTCCTTTCCTTGGAGAACGCAAGTTGTTTGACTCAAGAATG
CTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTGTCAATCCCAGTGCAGTCTTCCCAGAAAAGACCCTAAACACCT
CCTAGACTGCACCTGGGCCTACGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTTA
CATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGAAAACAGAAGCCTACATTTCAATGTGAGCCAGTCCCTCAAGG
CTCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTGG
GTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGC
CCAGGCTGCTCTGGGACGTTCCTCCTGATCTCAGGACGTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTG
AGCCTGGGCAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACCGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGCATC
TATTTCTCGTGATGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGATC
ACACGGCAAGAGAGGGAGCAAGGGGGAGGGGGAGCGATGGAGCTTCCAAGTTCTTTTGAACAACCAGCTCTCCAGGAACT
AATAGAGGGGGAACTAGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAA
CACCTCTCAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTAA
AGTAGTTGTGTCCTCAGCACATTCTATGGTTACTTTGAGAGCTATAACTGAGAAAGCAGGAGAAAGCTGGGTCTCCCGCC
ATCTGGGTGCTTGTCCTAAAGAGGTGTTTTACGTGGTTACCTGTCAATCAAGAAATGCGAGACAATTCATAAAGAGGAAC
TGCTATGATTAGCTTCTTATTGGTGTCTCATCTTCTTCCAGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAG
TGGTCATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAGTAAGTCTCACGAA
GGAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACTCAGGTGTGTGTTCCTCACAGGTAGGATGGT
CCCTGGCCCAAGGCAGCAGCCACAGAGGCAGGACTTTCTAGAGAGGGCACCAGACTCCCTGTCCCTGCTTTCAGCTCACA
GACCGTTGCCTGATTCTGAACTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGA
AAGTGGGAGACAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGTC
TGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGG
ACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTCCTACACATGCTGCTGTAATGGACCAAGAGCCTGCAGGG
AACAGAACAGCGAATAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAAC
GTGAGCACCCTCCCTCACTCAGGATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACA
GTTGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAG
TGTACACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGG
ATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGTG
AGTCTGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTTACAAATGTCTAAGGTC
CCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTC
CAACCTTACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAGTTCCAAACATACAAGAGGC
TCCCTCTTAACACGGCACTTAGACACGTCCTGTTCCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGAGTATCTTTCAG
CCTTCTGTCAGCAGTAAAACTTATATATTTTTTAAAATAATTTCAATGTAGTTTTCCCTCCTTCAAATAAACATGTCTGC
CCTCAT

IPD-KIR