Allele Report for 2DP1*0020107


2DP1*0020107
Previous Designations & Local Names: 2DP1_ABC08_ABhapTA
IPD Acc No: KIR00621
Assigned: 31-MAR-2010 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182361 , GU182362  
Cells Sequence Derived From: ABC08  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (1331 bps)
ATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGT
TTAACAACTTCAGTCTGTAAAAGGAAGATGGGGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTC
ATGGGCCCTGTGACCCCAGCACACACAGGGACGTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGC
ACCCAGCAACACCCTGGTGATCATGGCCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGA
AATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTT
AACGACACTTTGCACCTCACTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGA
CCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACAT
CGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCT
TGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCA
GGGCCCAAGGTCAACGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGG
CTCTTTCCGTGACTCTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATA
GTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTGGTC
ATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAATGCTGCTGTAATGGACCA
AGAGCCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGTTGG
ATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTGTAC
ACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGA
Genomic Sequence Data (13127 bps)
GTTCAGGAGGTTGGATCTGAGACGTGTTTTGAGTTGGTCATAGTGAAGGACGCTAGGTGTAAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAATGAGCCTGCGTACGTCACCCT
CCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCA
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAAT
AGAGGAAGGGAGTGTGGGGTTGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTGTGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTAGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGCCTGGAGTGC
CGATAGGAACCTGGAGGGGAGATAGGAGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTATAGGCCTATAGTAGAGA
TATGGGCCTGGAGTGGAGATTTGGGCCAGGAGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTAGAGTGGAAATAT
GGGCCTAGGATGGAGATATGGGCCTGGTTGTGGAGATATGGGACTGGAGAGGAGATATGGGCCTAGAGTGGAGATATGGG
CTTGGGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGGTGGAGTTACGGGCCTTCAGTAGAGATATGGGCCT
GGGGTGGAGATATGGGCTTGGGGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTACTGGCCTTCA
GTAGAGATATGGGCCTGGTGTGGAGATATGGGCCTGGATTGGAGATATGGGCCTAGGTTGGAGATCTGAGCCTGGAGTGG
AGATATGGGCCTGGATTGGAGATATGGGCTTACAGTGGAGATCTTGGCCTGGATTGGCGATATGGGCCTGGATTGGCGAT
ATGGGCCTATGATGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATACAGGCCTAGGGTGGAAATATTG
GCCTGGAGTGGAGATATGGGCTTGTGGTGGGGATATGGGCTTGTGGTGGGGATCTGGGCTTGGAGGCTGGGTCTCTGCAC
AGCCGACAGCCCTGTTCTTGGGTGCAGGTAGGCACTGAGGGTGAGTTTAACTTCAGTCCAGGAAGGGCCTGCCTACCAAG
ACTCACAGCCCAGTGAGGGCAGCAAGGGAGGGCTGGTTTGCCTGCAGATGGATCGTCCATCATGATCTTTCTTTCCAGGG
TTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAG
GATTTTCCTGAAACAGGAGGGAAGTCCTGTCAGGGAGCCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCC
ACAGTTCCGACCTCGCCTCCCTGGCCTTTCATTCCCTTGGCAGAGTCAAGTTCTGTGGGGACCAGGGTTAGACTGGGGTG
CTCAAAGCTGGGGTGCGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACTTCAGCG
TTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCACTCCACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACA
TTCCAAATCCTCTGATGGGGGCTCAGTTGCTTATTTTCATTCAGGCATCTGCTGATATTCCATTCTCAAAGACATGCCCT
CCACCCCATGTCTACCCTGTGTTGTTTTATGTGAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCAC
TTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGGGAGACACCTTGTGTTTGCGGGATGGGTCCTTCCTTTAGCCCTGG
GCACCAAGGTGTGATAGCAGCCATAGAAACTTGGAAAGCGAGGAGAATCTTCAGAGCACAGGGAGGGAGGGGTGGCTCCA
CATCCTCCTCTCTAAGGCGGTGCCTCCTTCTCCCCAAGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTG
TGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGTTTAACAACTTCAGTCTGTAAAAGGAAGATGGG
GTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTCATGGGCCCTGTGACCCCAGCACACACAGGGAC
GTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGCACCCAGCAACACCCTGGTGATCATGGCCACAG
GTCAGAGGGCTCCTGTCTTGGATTCTCCTTTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGCGTGTCCTTGAGGGTCC
CATCACCCAGGCCCTGACTATATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAATT
GTCCCCAGTGATGACTACATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGAACTGAAGGGGAAGATG
GAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGCTGGGCTCAGTGTAATCACAAGG
GTCCACATGAAAGGAGGAGGAAGAGGGGAGTGGGGATTAGAGCAGCGCAATGGGAGACTCCACCAGCTTTGAAGGTGGAG
GAAGGCCAGGAGCCATGAATGCAGGTGGCCTGTAGAGGTTGGAAAAGTCAAGGAAATGATTCTCCAGAGTCTCCAGAGGG
AACGAAGCCCTGCAGATGCCTTGATTTTAGCCCAGGAAAAACAGGGTCCTATTTCTGTCTCCAGTAGTGAAATGGGTCAG
TGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGA
CAAGGTAAGAAACAACACAAGGATAGCCGGGTGTGGTGGCAGGCGCATGTAATCCTAGCGACTTGGGAGGCTGAGGGCAG
GAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGACCCTAGACCACACCACTTCACTCCAGCTGGGGTGAAGGAGTG
AGACTCTGTCTCCATAATTAATTAATTAATTAAAGGAACCAAACAAGGGGAAGGTTGGCTACACCGAGATGAGCAAGTGT
GGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCAGCACCAGGAGCCAGCCTA
TGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCGACCAGGAACAGGGTGTGTGGACAC
TGGTGCCTGCCTTATTCATCAGTTCATACCTACTGCCAAGGATTCCAATTCATCCAAAAGAGATTGAACCAGGCTGATAA
GAGGCTGGATGTGCAGCCTATCCTGGTTCCTCTTTCACCCCCACATAAACAGCAGGAAAGACATTAGTGTGAAATAGATA
CAACACCCCAAGAGATGAGGCTAAGCCCAGTGGGAAGGGAATCAGAGGCGACTAGAGACAGAGGGACAGAGAAGAGGGAG
GGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGACA
GACACCAGCAAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAAC
CTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATC
CTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTTAACGACACTTTGCACCTCAC
TGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGACCTGGCAGGGACCTACAGAT
GCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTCATCACAGGTGAGAGTG
TCCGGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCACGACTTGGAACCCCCAGGTAGTTGTAAGGAAGA
TGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAGTA
CAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAGGAGTTAAAGGAGACAG
ACAGACAGACATGTCCCAGAGAGAGGTGTCCCTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATT
TCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGG
CCTCAGGCCTTGTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGTAATGGAGAGTAACCGTCCCA
GGATATCATGGCCCCAGAACACCAACTCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATT
CCAAATAACCCCACATATGAAAGGATCACTGAGAGGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACAC
ACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAAAGAGGGCAGAGGAGTGGTGA
GAATGATGGAAGGGAGCAGAGAAAAGCACTAAAATTAGACTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGATG
TGGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATA
TAGATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTGATTCATTAATAGATG
AGACATAGAGATGATGATGATGAAGACAGATAGATAATACATAGAGATAGAGAGGCAGACAGAAGTCATAGAGAGAGAGA
TGATACATAGATATAGATAACAGATGATTGATGGATAGATAGACAAGTGATAGATACATAGATGATATATAGATATAGAT
GACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATAGATCGATAGATAATAGATAGAAATATGCAGAAAG
TTATGAACAGGACACAAAGTGAGAAACTTAGAATTTAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGTCAGAGAG
AATAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGTGGAAGCGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGGA
AGGAGGAAATAGACATGAAGAGAGATGGGGTGGAGGGTGAGAGAGAGAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGG
AGTGAGTTCTCAGCTCAGGTGAAGGGAGCTGTGACAAGGAAGATCCTCCGTAAGGAAAATGCCTCTTCTCCTTCCAGGTC
TATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCC
CGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAA
CGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACT
CTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAAGCCCATGGCTGTCCCATGTC
CTATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGAGGATGGAGAGAAGGATGAACAGATGCAGAGAGAAGACGAAG
CTTGGGTGTGAGGGAGGGATCAGGGCACAGGATGGCAGACAGGGCACCTCCAAACCCTCCTACATGGCCTGCATGAAGGC
CTGCGGCCAGGACTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGAGAGACCCAGAGGAGGGAGACTGGGCTCAGTT
TGGGAAGATCAGAGGTTCCCTCAGCCCCTCAACATTACCCATTTCCCAGAAGCCCATCCTGGCCTCCCACCCACACAGGG
ATGTCATCACCTGCAACCCCTACACCCTTTACTTTTGTTTGAGAAATATTTATTGAGGATAAATATACCTATATAGCTTA
CCACCTTTAACATTTTTTTTTTGAGGCGGAGTCTAGCTCTGTCCCCTATGCTGGAGTGCATTGGCACAATCTCAGCTCAC
TGCAACTTCCGCCTCCTGGGTTCAAGCGATTCTCTTGCCTCAGCCACCTGAGTAGCTGGTGCTACAGGCGCGCACCACCA
TGCCAGGCTACTTTTTGTATTTTTAGTAGAGAGGGGGTTTCACCATGTTGGTCAAGCTGGTCTCGAACTCCTGACCACGT
GATCCACCCGCATCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCAGCCACATTTACCATTTTTAAG
TGTAAAGTCTAGTGGTCATAAATACATTAATATATATATATATACACATATTTTTTTTTACCCTCCACCCTTTTCTTCCT
GGCCTCTGGTAGCCACCATTCTACTCTCTACCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTAAGAAATGGGAA
TCTTTGTAATGACCTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTTTTCTTTCTATGGAAGAGTAGTCTCCAC
TATGCAAATGTACCACATTCTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCTCATCTTGGCTACTGTGA
AGAGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATATATTGATTTACTTTCCTTTGGATATAAACCCAGTAGT
GAAATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTC
TGTGCCCAGGCTGGAGTACAAGTGATGTCATCTTGGCTCATTGCAACCTCTGCCTCCTGGGTTCAAATGATTTTCCTGCC
TCAGCCTCCCTAGTATCAGGGATTATAGGCGCACGCCACCATGCCTGGCTACTTTTTGTTTTTTTTAGTATAGATGCGGT
TTCCCCATGTTGGCTGGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATT
ACAGGCATGATCCACCTCACCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCACACTTTTCTCCGTAATGGCTGTACTAA
TTTACACTCCTACCAACAGGATACCAGGATTCTCCTTTCTCTAACACCTTGCCAGCATTTCTTTTGCCTGTCTTGCAGCT
AAAAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGAGTGCAGTGGTGCGAT
CTCGGCTCACCACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCA
CACGCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGTGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTC
CCGACCTTATGAGATTCACCCACCTCAGGCTCTCAAAGTTCTAGGATGACAGACGTGAGCCACCACGCCCGGCCTAAAAG
CCATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTTGTGTTTCTCTGATGATGAGTGATACTGAGCACTTTT
TCGTATGTGGGGAAATTTCATGTCTTTTGCTCCTGTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTAT
ATTTCTAGTTATTAATCCCATCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGT
TGGTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTT
TGAAGGTTTAAAACAAAATGTCTTCCTTCAGACAAACGTCCTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCATA
GGTTCAGGCCTTAGACTCACATCTTTAATCCATTTTCATTTGATTTTTGTGTATAGTGACAGGCAGAGGTGCAGTTTCAT
TCCTCTGCATGTCGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAGACTGTCCTTTCCTGATTGTGAGTTCTTGGCAC
CTTTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTGACACCTGCAATTTCAGCACTTTGGGAGCCCGAGGTGGGTG
GATCACCTGAGGCCAAGAGTTCAAGATTAGTCTGGCCAACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGC
TGAGCATGGTGGTCAGCACCTGTAATACCACTACTCAGGAGTTTGAGGCAAGAGAAGTGATTGAACCCAGGAGGCTGTGG
TGGCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAACAAAAAA
TACATTGGAGGTAAATGCATGGATTATATCTGTGTTATTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAAC
GTCATGCTGTCTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACC
TTGAAGTCTCAAGACAGTAGCCGTCACATACAAAAATTACGGAAAAAAGGATCCCAGGACTCCCAGGGCCCAATATTAGA
TAACAGAGTGTTGGCCATGAACCAACCTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTC
CTGTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGAAC
CCTCTTATATCCGCTTTTGGAAACCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGAC
ATTGTACGCCTGTCTTCTACCATCTCCAAACTCCAGATACTCCAACAGCGAAAGGGATCTGGACCCAAAACAGGGCTCTG
TGAAATCTCTTAATCTCTCATTTTATGGAGCTGAGATCTCCTACAAGCTAGAAAAATGATTGGCAATCTGACATCCTTCT
CAGGAAAAATGCAATGTTTGTTCTGCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGTAG
GGAACATTTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCCAGGAATGAATTACTGTTGGTCATGAAGCAACCC
TGGCTGACTCAGCAGAGCAAGAGCTTTGCCTTAACAGAGAACGGAGCTCATGCACGCACACTTCGACTCACTGACTCATT
CAGCCACGGCCCCATGCTCAGGCCGTGGAAAAGGCAATTCCCAGCACTGCAGGAGGCCAAGGCGGGTGGATCACTTGAAG
TCAGGAGTTCCAGACCAGCCTGGCCAAAATGGTGAAACCCTGTCTCTATGAAAAATACAAAAATTAGCCGAGCATGGTGG
TGCATCCCTGTAATCCCAGCTCCTACTCTTGAGGATGAAGCAGGAGAACGACTTCAACCCAGGAGGTGGAGGTTGCAGTG
AGTGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATA
AATATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTGTATTTCTCTATAATTACTTCTTT
GATCCTTTGTCTTATCCATTAGGCAATGAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGACCATATAGA
AAATGTGAAAGCCCGCTGAATCCTCCAGCACAGATCGTGGAATAGAGAAAGTGCTCTGTTCATCACAAAAAAAACTTGCC
CTCTCACTCAAATCCCCCACTTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGTAAACATTA
ATACTCCTTGGAGTGAGTCCAGATCTTGGAATGAGAGATCAGCACCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTC
ACAGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCAGGTAGAACAGCAGCC
TAACATGTGTCTCCCGAGATCACAAAGAGTAGGACGTTTCACAGGGGCTTCAACACGATTTCCTGGCTGTTGGACATAAG
ATAACTCTATTTCGCTTTTTTATCTTGATTTCACTTTTGTTTCCTTTCCTTGGAGAACGCAAGTTGTTTGACTCAAGAAT
GCTGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTGTCAATCCCAGTGCAGTCTTCCCAGAAAAGACCCTAAACACC
TCCTAGACTGCACCTGGGCCTACGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTT
ACATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGAAAACAGAAGCCTACATTTCAATGTGAGCCAGTCCCTCAAG
GCTCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTG
GGTTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAG
CCCAGGCTGCTCTGGGACGTTCCTCCTGATCTCAGGACGTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTT
GAGCCTGGGCAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACCGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGCAT
CTATTTCTCGTGATGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGAT
CACACGGCAAGAGAGGGAGCAAGGGGGAGGGGGAGCGATGGAGCTTCCAAGTTCTTTTGAACAACCAGCTCTCCAGGAAC
TAATAGAGGGGGAACTAGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAA
ACACCTCTCAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTA
AAGTAGTTGTGTCCTCAGCACATTCTATGGTTACTTTGAGAGCTATAACTGAGAAAGCAGGAGAAAGCTGGGTCTCCCGC
CATCTGGGTGCTTGTCCTAAAGAGGTGTTTTACGTGGTTACCTGTCAATCAAGAAATGCGAGACAATTCATAAAGAGGAA
CTGCTATGATTAGCTTCTTATTGGTGTCTCATCTTCTTCCAGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCA
GTGGTCATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAGTAAGTCTCACGA
AGGAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACTCAGGTGTGTGTTCCTCACAGGTAGGATGG
TCCCTGGCCCAAGGCAGCAGCCACAGAGGCAGGACTTTCTAGAGAGGGCACCAGACTCCCTGTCCCTGCTTTCAGCTCAC
AGACCGTTGCCTGATTCTGAACTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAG
AAAGTGGGAGACAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGT
CTGAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAG
GACCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTCCTACACATGCTGCTGTAATGGACCAAGAGCCTGCAGG
GAACAGAACAGCGAATAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAA
CGTGAGCACCCTCCCTCACTCAGGATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTAC
AGTTGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGA
GTGTACACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGG
GATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGT
GAGTCTGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTTACAAATGTCTAAGGT
CCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCT
CCAACCTTACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAGTTCCAAACATACAAGAGG
CTCCCTCTTAACACGGCACTTAGACACGTCCTGTTCCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGAGTATCTTTCA
GCCTTCTGTCAGCAGTAAAACTTATATATTTTTTAAAATAATTTCAATGTAGTTTTCCCTCCTTCAAATAAACATGTCTG
CCCTCAT

IPD-KIR