Allele Report for 2DP1*0020103


2DP1*0020103
Previous Designations & Local Names: ABC08_A1hap
IPD Acc No: KIR00442
Assigned: 28-AUG-2009 Sequence Last Modified: 16-AUG-2010
Source Entries: GU182348 , GU182360  
Cells Sequence Derived From: ABC08 , G085  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 2 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (1331 bps)
ATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGT
TTAACAACTTCAGTCTGTAAAAGGAAGATGGGGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTC
ATGGGCCCTGTGACCCCAGCACACACAGGGACGTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGC
ACCCAGCAACACCCTGGTGATCATGGCCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGA
AATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTT
AACGACACTTTGCACCTCACTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGA
CCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACAT
CGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCT
TGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCA
GGGCCCAAGGTCAACGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGG
CTCTTTCCGTGACTCTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATA
GTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTGGTC
ATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAATGCTGCTGTAATGGACCA
AGAGCCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGTTGG
ATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTGTAC
ACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGA
Genomic Sequence Data (13125 bps)
GTTCAGGAGGTTGGATCTGAGACGTGTTTTGAGTTGGTCATAGTGAAGGACGCTAGGTGTAAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAATGAGCCTGCGTACGTCACCCT
CCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCA
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAAT
AGAGGAAGGGAGTGTGGGGTTGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTGTGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTAGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGCCTGGAGTGC
CGATAGGAACCTGGAGGGGAGATAGGAGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTATAGGCCTATAGTAGAGA
TATGGGCCTGGAGTGGAGATTTGGGCCAGGAGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTAGAGTGGAAATAT
GGGCCTAGGATGGAGATATGGGCCTGGTTGTGGAGATATGGGACTGGAGAGGAGATATGGGCCTAGAGTGGAGATATGGG
CTTGGGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGGTGGAGTTACGGGCCTTCAGTAGAGATATGGGCCT
GGGGTGGAGATATGGGCTTGGGGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTACTGGCCTTCA
GTAGAGATATGGGCCTGGTGTGGAGATATGGGCCTGGATTGGAGATATGGGCCTAGGTTGGAGATCTGAGCCTGGAGTGG
AGATATGGGCCTGGATTGGAGATATGGGCTTACAGTGGAGATCTTGGCCTGGATTGGCGATATGGGCCTGGATTGGCGAT
ATGGGCCTATGATGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATACAGGCCTAGGGTGGAAATATTG
GCCTGGAGTGGAGATATGGGCTTGTGGTGGGGATATGGGCTTGTGGTGGGGATCTGGGCTTGGAGGCTGGGTCTCTGCAC
AGCCGACAGCCCTGTTCTTGGGTGCAGGTAGGCACTGAGGGTGAGTTTAACTTCAGTCCAGGAAGGGCCTGCCTACCAAG
ACTCACAGCCCAGTGAGGGCAGCAAGGGAGGGCTGGTTTGCCTGCAGATGGATCGTCCATCATGATCTTTCTTTCCAGGG
TTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTAGGGTGTCATCTCCCCACATAAGAG
GATTTTCCTGAAACAGGAGGGAAGTCCTGTCAGGGAGCCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCC
ACAGTTCCGACCTCGCCTCCCTGGCCTTTCATTCCCTTGGCAGAGTCAAGTTCTGTGGGGACCAGGGTTAGACTGGGGTG
CTCAAAGCTGGGGTGCGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACTTCAGCG
TTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCACTCCACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACA
TTCCAAATCCTCTGATGGGGGCTCAGTTGCTTATTTTCATTCAGGCATCTGCTGATATTCCATTCTCAAAGCATGCCCTC
CACCCCATGTCTACCCTGTGTTGTTTTATGTGAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCACT
TGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGGGAGACACCTTGTGTTTGCGGGATGGGTCCTTCCTTTAGCCCTGGG
CACCAAGGTGTGATAGCAGCCATAGAAACTTGGAAAGCGAGGAGAATCTTCAGAGCACAGGGAGGGAGGGGTGGCTCCAC
ATCCTCCTCTCTAAGGCGGTGCCTCCTTCTCCCCAAGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGT
GGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGTTTAACAACTTCAGTCTGTAAAAGGAAGATGGGG
TGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTCATGGGCCCTGTGACCCCAGCACACACAGGGACG
TACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGCACCCAGCAACACCCTGGTGATCATGGCCACAGG
TCAGAGGGCTCCTGTCTTGGATTCTCCTTTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGCGTGTCCTTGAGGGTCCC
ATCACCCAGGCCCTGACTATATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAATTG
TCCCCAGTGATGACTACATTCTAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGAACTGAAGGGGAAGATGG
AGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGCTGGGCTCAGTGTAATCACAAGGG
TCCACATGAAAGGAGGAGGAAGAGGGGAGTGGGGATTAGAGCAGCGCAATGGGAGACTCCACCAGCTTTGAAGGTGGAGG
AAGGCCAGGAGCCATGAATGCAGGTGGCCTGTAGAGGTTGGAAAAGTCAAGGAAATGATTCTCCAGAGTCTCCAGAGGGA
ACGAAGCCCTGCAGATGCCTTGATTTTAGCCCAGGAAAAACAGGGTCCTATTTCTGTCTCCAGTAGTGAAATGGGTCAGT
GTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGAC
AAGGTAAGAAACAACACAAGGATAGCCGGGTGTGGTGGCAGGCGCATGTAATCCTAGCGACTTGGGAGGCTGAGGGCAGG
AGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGACCCTAGACCACACCACTTCACTCCAGCTGGGGTGAAGGAGTGA
GACTCTGTCTCCATAATTAATTAATTAATTAAAGGAACCAAACAAGGGGAAGGTTGGCTACACCGAGATGAGCAAGTGTG
GGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTGATACTCCTCAAACCAGCACCAGGAGCCAGCCTAT
GGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCGACCAGGAACAGGGTGTGTGGACACT
GGTGCCTGCCTTATTCATCAGTTCATACCTACTGCCAAGGATTCCAATTCATCCAAAAGAGATTGAACCAGGCTGATAAG
AGGCTGGATGTGCAGCCTATCCTGGTTCCTCTTTCACCCCCACATAAACAGCAGGAAAGACATTAGTGTGAAATAGATAC
AACACCCCAAGAGATGAGGCTAAGCCCAGTGGGAAGGGAATCAGAGGCGACTAGAGACAGAGGGACAGAGAAGAGGGAGG
GAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGACAG
ACACCAGCAAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAACC
TCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATCC
TGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTTAACGACACTTTGCACCTCACT
GGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGACCTGGCAGGGACCTACAGATG
CTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTCATCACAGGTGAGAGTGT
CCGGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCACGACTTGGAACCCCCAGGTAGTTGTAAGGAAGAT
GAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAGTAC
AGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAGGAGTTAAAGGAGACAGA
CAGACAGACATGTCCCAGAGAGAGGTGTCCCTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATTT
CTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGGC
CTCAGGCCTTGTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGTAATGGAGAGTAACCGTCCCAG
GATATCATGGCCCCAGAACACCAACTCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATTC
CAAATAACCCCACATATGAAAGGATCACTGAGAGGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACACA
CAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAAAGAGGGCAGAGGAGTGGTGAG
AATGATGGAAGGGAGCAGAGAAAAGCACTAAAATTAGACTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGATGT
GGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGATGGATAGATATA
GATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTGATTCATTAATAGATGAG
ACATAGAGATGATGATGATGAAGACAGATAGATAATACATAGAGATAGAGAGGCAGACAGAAGTCATAGAGAGAGAGATG
ATACATAGATATAGATAACAGATGATTGATGGATAGATAGACAAGTGATAGATACATAGATGATATATAGATATAGATGA
CAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATAGATCGATAGATAATAGATAGAAATATGCAGAAAGTT
ATGAACAGGACACAAAGTGAGAAACTTAGAATTTAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGTCAGAGAGAA
TAAAACAATCCAAAAAGGGAAAACATATCTAGAGGTGTGGAAGCGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGGAAG
GAGGAAATAGACATGAAGAGAGATGGGGTGGAGGGTGAGAGAGAGAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGGAG
TGAGTTCTCAGCTCAGGTGAAGGGAGCTGTGACAAGGAAGATCCTCCGTAAGGAAAATGCCTCTTCTCCTTCCAGGTCTA
TATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCG
GAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAACG
GAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACTCT
CCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAAGCCCATGGCTGTCCCATGTCCT
ATGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGAGGATGGAGAGAAGGATGAACAGATGCAGAGAGAAGACGAAGCT
TGGGTGTGAGGGAGGGATCAGGGCACAGGATGGCAGACAGGGCACCTCCAAACCCTCCTACATGGCCTGCATGAAGGCCT
GCGGCCAGGACTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGAGAGACCCAGAGGAGGGAGACTGGGCTCAGTTTG
GGAAGATCAGAGGTTCCCTCAGCCCCTCAACATTACCCATTTCCCAGAAGCCCATCCTGGCCTCCCACCCACACAGGGAT
GTCATCACCTGCAACCCCTACACCCTTTACTTTTGTTTGAGAAATATTTATTGAGGATAAATATACCTATATAGCTTACC
ACCTTTAACATTTTTTTTTTGAGGCGGAGTCTAGCTCTGTCCCCTATGCTGGAGTGCATTGGCACAATCTCAGCTCACTG
CAACTTCCGCCTCCTGGGTTCAAGCGATTCTCTTGCCTCAGCCACCTGAGTAGCTGGTGCTACAGGCGCGCACCACCATG
CCAGGCTACTTTTTGTATTTTTAGTAGAGAGGGGGTTTCACCATGTTGGTCAAGCTGGTCTCGAACTCCTGACCACGTGA
TCCACCCGCATCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCAGCCACATTTACCATTTTTAAGTG
TAAAGTCTAGTGGTCATAAATACATTAATATATATATATATACACATATTTTTTTTTACCCTCCACCCTTTTCTTCCTGG
CCTCTGGTAGCCACCATTCTACTCTCTACCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTAAGAAATGGGAATC
TTTGTAATGACCTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTTTTCTTTCTATGGAAGAGTAGTCTCCACTA
TGCAAATGTACCACATTCTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCTCATCTTGGCTACTGTGAAG
AGTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATATATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGA
AATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTG
TGCCCAGGCTGGAGTACAAGTGATGTCATCTTGGCTCATTGCAACCTCTGCCTCCTGGGTTCAAATGATTTTCCTGCCTC
AGCCTCCCTAGTATCAGGGATTATAGGCGCACGCCACCATGCCTGGCTACTTTTTGTTTTTTTTAGTATAGATGCGGTTT
CCCCATGTTGGCTGGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTAC
AGGCATGATCCACCTCACCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCACACTTTTCTCCGTAATGGCTGTACTAATT
TACACTCCTACCAACAGGATACCAGGATTCTCCTTTCTCTAACACCTTGCCAGCATTTCTTTTGCCTGTCTTGCAGCTAA
AAGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGAGTGCAGTGGTGCGATCT
CGGCTCACCACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACA
CGCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGTGTTTCTCCATGTGGGTCAGACTGGTCTCAAACTCCC
GACCTTATGAGATTCACCCACCTCAGGCTCTCAAAGTTCTAGGATGACAGACGTGAGCCACCACGCCCGGCCTAAAAGCC
ATTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTTGTGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTC
GTATGTGGGGAAATTTCATGTCTTTTGCTCCTGTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATAT
TTCTAGTTATTAATCCCATCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTG
GTTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTG
AAGGTTTAAAACAAAATGTCTTCCTTCAGACAAACGTCCTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCATAGG
TTCAGGCCTTAGACTCACATCTTTAATCCATTTTCATTTGATTTTTGTGTATAGTGACAGGCAGAGGTGCAGTTTCATTC
CTCTGCATGTCGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAGACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCT
TTGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTGACACCTGCAATTTCAGCACTTTGGGAGCCCGAGGTGGGTGGA
TCACCTGAGGCCAAGAGTTCAAGATTAGTCTGGCCAACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTG
AGCATGGTGGTCAGCACCTGTAATACCACTACTCAGGAGTTTGAGGCAAGAGAAGTGATTGAACCCAGGAGGCTGTGGTG
GCAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAACAAAAAATA
CATTGGAGGTAAATGCATGGATTATATCTGTGTTATTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACGT
CATGCTGTCTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTT
GAAGTCTCAAGACAGTAGCCGTCACATACAAAAATTACGGAAAAAAGGATCCCAGGACTCCCAGGGCCCAATATTAGATA
ACAGAGTGTTGGCCATGAACCAACCTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCT
GTCTCATGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGAACCC
TCTTATATCCGCTTTTGGAAACCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACAT
TGTACGCCTGTCTTCTACCATCTCCAAACTCCAGATACTCCAACAGCGAAAGGGATCTGGACCCAAAACAGGGCTCTGTG
AAATCTCTTAATCTCTCATTTTATGGAGCTGAGATCTCCTACAAGCTAGAAAAATGATTGGCAATCTGACATCCTTCTCA
GGAAAAATGCAATGTTTGTTCTGCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGTAGGG
AACATTTGATGAGGGCGAGGTGTTTTAGAGAAGTTCCACTTGCCCAGGAATGAATTACTGTTGGTCATGAAGCAACCCTG
GCTGACTCAGCAGAGCAAGAGCTTTGCCTTAACAGAGAACGGAGCTCATGCACGCACACTTCGACTCACTGACTCATTCA
GCCACGGCCCCATGCTCAGGCCGTGGAAAAGGCAATTCCCAGCACTGCAGGAGGCCAAGGCGGGTGGATCACTTGAAGTC
AGGAGTTCCAGACCAGCCTGGCCAAAATGGTGAAACCCTGTCTCTATGAAAAATACAAAAATTAGCCGAGCATGGTGGTG
CATCCCTGTAATCCCAGCTCCTACTCTTGAGGATGAAGCAGGAGAACGACTTCAACCCAGGAGGTGGAGGTTGCAGTGAG
TGGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAAA
TATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTGTATTTCTCTATAATTACTTCTTTGA
TCCTTTGTCTTATCCATTAGGCAATGAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGACCATATAGAAA
ATGTGAAAGCCCGCTGAATCCTCCAGCACAGATCGTGGAATAGAGAAAGTGCTCTGTTCATCACAAAAAAAACTTGCCCT
CTCACTCAAATCCCCCACTTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGTAAACATTAAT
ACTCCTTGGAGTGAGTCCAGATCTTGGAATGAGAGATCAGCACCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTCAC
AGGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCAGGTAGAACAGCAGCCTA
ACATGTGTCTCCCGAGATCACAAAGAGTAGGACGTTTCACAGGGGCTTCAACACGATTTCCTGGCTGTTGGACATAAGAT
AACTCTATTTCGCTTTTTTATCTTGATTTCACTTTTGTTTCCTTTCCTTGGAGAACGCAAGTTGTTTGACTCAAGAATGC
TGTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTGTCAATCCCAGTGCAGTCTTCCCAGAAAAGACCCTAAACACCTC
CTAGACTGCACCTGGGCCTACGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTTAC
ATAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGAAAACAGAAGCCTACATTTCAATGTGAGCCAGTCCCTCAAGGC
TCAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGG
TTTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCC
CAGGCTGCTCTGGGACGTTCCTCCTGATCTCAGGACGTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGA
GCCTGGGCAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACCGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGCATCT
ATTTCTCGTGATGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGATCA
CACGGCAAGAGAGGGAGCAAGGGGGAGGGGGAGCGATGGAGCTTCCAAGTTCTTTTGAACAACCAGCTCTCCAGGAACTA
ATAGAGGGGGAACTAGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAAC
ACCTCTCAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTAAA
GTAGTTGTGTCCTCAGCACATTCTATGGTTACTTTGAGAGCTATAACTGAGAAAGCAGGAGAAAGCTGGGTCTCCCGCCA
TCTGGGTGCTTGTCCTAAAGAGGTGTTTTACGTGGTTACCTGTCAATCAAGAAATGCGAGACAATTCATAAAGAGGAACT
GCTATGATTAGCTTCTTATTGGTGTCTCATCTTCTTCCAGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGT
GGTCATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAGTAAGTCTCACGAAG
GAGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACTCAGGTGTGTGTTCCTCACAGGTAGGATGGTC
CCTGGCCCAAGGCAGCAGCCACAGAGGCAGGACTTTCTAGAGAGGGCACCAGACTCCCTGTCCCTGCTTTCAGCTCACAG
ACCGTTGCCTGATTCTGAACTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGAA
AGTGGGAGACAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGTCT
GAGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGA
CCCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTCCTACACATGCTGCTGTAATGGACCAAGAGCCTGCAGGGA
ACAGAACAGCGAATAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAACG
TGAGCACCCTCCCTCACTCAGGATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAG
TTGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGT
GTACACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGGA
TCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGTGA
GTCTGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTTACAAATGTCTAAGGTCC
CCACTGCCTGCTGGAGAAAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTCC
AACCTTACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAGTTCCAAACATACAAGAGGCT
CCCTCTTAACACGGCACTTAGACACGTCCTGTTCCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGAGTATCTTTCAGC
CTTCTGTCAGCAGTAAAACTTATATATTTTTTAAAATAATTTCAATGTAGTTTTCCCTCCTTCAAATAAACATGTCTGCC
CTCAT

IPD-KIR