Allele Report for 2DP1*0020101


2DP1*0020101
Previous Designations & Local Names: -
IPD Acc No: KIR00053
Assigned: 28-JUN-2003 Sequence Last Modified: 17-JUL-2003
Source Entries: AC011501  
Cells Sequence Derived From: UV5HL9-5B  
Known Ethnic Origin Of Source: Unknown
Publications
Martin AM et al. Immunogenetics 51:268-80 2000. abstract
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
Protein Sequence (0 aa)
Nucleotide Sequence Data (1331 bps)
ATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGGTCAGGA
CAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTGTGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGT
TTAACAACTTCAGTCTGTAAAAGGAAGATGGGGTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTC
ATGGGCCCTGTGACCCCAGCACACACAGGGACGTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGC
ACCCAGCAACACCCTGGTGATCATGGCCACAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGA
AATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTT
AACGACACTTTGCACCTCACTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGA
CCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACAT
CGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCT
TGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCA
GGGCCCAAGGTCAACGGAACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGG
CTCTTTCCGTGACTCTCCCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATA
GTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTGGTC
ATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAATGCTGCTGTAATGGACCA
AGAGCCTGCAGGGAACAGAACAGCGAATAGCGAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGTTGG
ATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTGTAC
ACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGA
Genomic Sequence Data (13124 bps)
GTTCAGGAGGTTGGATCTGAGACGTGTTTTGAGTTGGTCATAGTGAAGGACGCTAGGTGTAAATTCTAGTGAGAACAATT
TCCAGGAAGCCGTGTTCCGCTCTTGAGCGAGCACCCACTGGGCCTCATGCAAGGTAGAATGAGCCTGCGTACGTCACCCT
CCCATGATGTGGTCAACATGTAAACTGCATGGGCAGGGCGCCAAATAACATCCTGTGCGCTGCTGAGCTGAGCTGGGGCG
CGGCCGCCTGTCTGCACCGGCAGCACCATGTCGCTCACGGTCGTCAGCATGGCGTGTGTTGGTGAGTCCTGGAAGGGAAT
AGAGGAAGGGAGTGTGGGGTTGGAGATCTGGGCCCAGAGGTGGAGATATAGGCCTGGAGGTGGAGTTGTGGGCCTGGAGT
GGAGATCTGGGCCTGGAGTGGATATATGGGCCTAGAGATGGAGTGATGGGCCTAGAAGTGGAGATCTGGGCCTGGAGTGC
CGATAGGAACCTGGAGGGGAGATAGGAGCCTGGAGTGGAGACATGGGCCTGGAGGTGGAGTTATAGGCCTATAGTAGAGA
TATGGGCCTGGAGTGGAGATTTGGGCCAGGAGTGGAGATATGGGCCTAGAGGTGGATATCTGGGCCTAGAGTGGAAATAT
GGGCCTAGGATGGAGATATGGGCCTGGTTGTGGAGATATGGGACTGGAGAGGAGATATGGGCCTAGAGTGGAGATATGGG
CTTGGGGTGGAGATCTGGGCCTGGGGTGGAGATATGGGCCTGGAGGTGGAGTTACGGGCCTTCAGTAGAGATATGGGCCT
GGGGTGGAGATATGGGCTTGGGGTGGAGATCTGGGCCTGGAGTGGAGATATGGGCCTGGAGGTGGAGTTACTGGCCTTCA
GTAGAGATATGGGCCTGGTGTGGAGATATGGGCCTGGATTGGAGATATGGGCCTAGGGTGGAGATCTGAGCCTGGGGTGG
AGATATGGGCCTGGATTGGAGATATGGGCTTACAGTGGAGATCTTGGCCTGGATTGGCGATATGGGCCTGGATTGGCGAT
ATGGGCCTATGATGGAAATATCGGCCTGGAGTGGAGATATGGGCCTGGAGTGGAGATACAGGCCTAGGGTGGAAATATTG
GCCTGGAGTGGAGATATGGGCTTGTGGTGGGGATATGGGCTTGTGGTGGGGATCTGGGCTTGGAGGCTGGGTCTCTGCAC
AGCCGACAGCCCTGTTCTTGGGTGCAGGTAGGCACTGAGGGTGAGTTTAACTTCAGTCCAGGAAGGGCCTGCCTACCAAG
ACTCACAGCCCAGTGAGGGCAGCAAGGGTGCCCTGGTTTGCCTGCAGATGGATCGTCCATCATGATCTTTCTTTCCAGGG
TTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGTGAGTCCTTCTCCAAACCTTCGGGTGTCATCTCCCCACATAAGAG
GATTTTCCTGAAACAGGAGGGAAGTCCTGTCAGGGAGCCTCTCATAAACTAGGAAGAGGGGACCCTGGGGTGCTCGGCCC
ACAGTTCCGACCTCGCCTCCCTGGCCTTTCATTCCCTTGGCAGAGTCAAGTTCTGTGGGGACCAGGGTTAGACTGGGGTG
CTCAAAGCTGGGGTGCGTGGTGGGGAAGTGGTAGGAACAGCAGATCCTCTGAGGACAAAGGTGTTACTCACACTTCAGCG
TTTCCATGACGGTAGGGGCTGCAGTGTGGCTGCTGTCACTCCACCAGAAGAGGTGGGAAACCACAGCCATGGCCCTGACA
TTCCAAATCCTCTGATGGGGGCTCAGTTGCTTATTTTCATTCAGGCATCTGCTGATATTCCATTCTCAAAGACATGCCCT
CCACCCCATGTCTACCCTGTGTTGTTTTATGTGAGTAATCTTACAGTATTAAAATCTAGTAGGAGTCTCTTACTCAGCAC
TTGCTCAAAGTTCTCAGCTGACACTTTTGTTGTAGGGAGACACCTTGTGTTTGCGGGATGGGTCCTTCCTTTAGCCCTGG
GCACCAAGGTGTGATAGCAGCCATAGAAACTTGGAAAGCGAGGAGAATCTTCAGAGCACAGGGAGGGAGGGGTGGCTCCA
CATCCTCCTCTCTAAGGCGGTGCCTCCTTCTCCCCAAGGTGGTCAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCTCTG
TGGTGCCTCCAGGACATGTGATTCTTCGGTGTCATTCTTATCTTGGGTTTAACAACTTCAGTCTGTAAAAGGAAGATGGG
GTGCCTGGCACTGAGCTCTACAACAGAATATTCTGGAAGAGCCTTTTCATGGGCCCTGTGACCCCAGCACACACAGGGAC
GTACAGATGTCGGGGTTCACACCCACACTACCCCAGTGGGTGGTCGGCACCCAGCAACACCCTGGTGATCATGGCCACAG
GTCAGAGGGCTCCTGTCTTGGATTCTCCTTTCCCACCTCCTGAATCCCAGAGCTTCTGGTGGGCGTGTCCTTGAGGGTCC
CATCACCCAGGCCCTGACTATATTTGGGGTAAAGGGGGATTGAATACAGGGAAATGGGTGCTGTGGTGGGAAGAATAATT
GTCCCCAGTGATGACTACATTCAAATCCCTGGAGTCTGTGACTATTTATGTTATAGGGGAAGGAACTGAAGGGGAAGATG
GAGCTCAGGTTGTTGATGAGTTGACCTTGAGATGGGGAGACAGCCTGGACTGTCCCGCTGGGCTCAGTGTAATCACAAGG
GTCCACATGAAAGGAGGAGGAAGAGGGGAGTGGGGATTAGAGCAGCGCAATGGGAGACTCCACCAGCTTTGAAGGTGGAG
GAAGGCCAGGAGCCATGAATGCAGGTGGCCTGTAGAGGTTGGAAAAGTCAAGGAAATGATTCTCCAGAGTCTCCAGAGGG
AACGAAGCCCTGCAGATGCCTTGATTTTAGCCCAGGAAAAACAGGGTCCTATTTCTGTCTCCAGTAGTGAAATGGGTCAG
TGTGCTCTCTCCTGCTGCCATGCTTCTGATAATTTTCTACAGCAGCAACAGGAAACCAACACTGGAACCCAGGTCAAGGA
CAAGGTAAGAAACAACACAAGGATAGCCGGGTGTGGTGGCAGGCGCATGTAATCCTAGCGACTTGGGAGGCTGAGGGCAG
GAGAATCACTTGAACCCAGGAGACAGAGGTTGCAGTGACCCTAGACCACACCACTTCACTCCAGCTGGGGTGAAGGAGTG
AGACTCTGTCTCCATAATTAATTAATTAATTAAAGGAACCAAACAAGGGGAAGGTTGGCTACACCGAGATGAGCAAGTGT
GGGATGATGATGCCACCACCAGGCTCCATCCACATAGGGAGGGGTTAATACTCCTCAAACCAGCACCAGGAGCCAGCCTA
TGGAAGCTGGCACCATGGAGAAGGCACAGGCATGGCAAGAGTGGCTCCCAGTCCCGACCAGGAACAGGGTGTGTGGACAC
TGGTGCCTGCCTTATTCATCAGTTCATACCTACTGCCAAGGATTCCAATTCATCCAAAAGAGATTGAACCAGGCTGATAA
GAGGCTGGATGTGCAGCCTATCCTGGTTCCTCTTTCACCCCCACATAAACAGCAGGAAAGACATTAGTGTGAAATAGATA
CAACACCCCAAGAGATGAGGCTAAGCCCAGTGGGAAGGGAATCAGAGGCGACTAGAGACAGAGGGACAGAGAAGAGGGAG
GGAGACAGATGGAAGGACCTGCACCAGGAGTTATGGGCACAGAAAAGAACATGAAGACACAGAGAGGAAGGAGAGAGACA
GACACCAGCAAGGGGAAGCCTCACTCATTCTAGGTGCCATGGATGGGATGATAAAGAGAGACACCTTCTAAACTCACAAC
CTCTCTTCCTAGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATC
CTGCAATGTTGGTCAGATGTCAGGTTTCAGCACTTCCTTCTGCACAGAGAAGGGAAGTTTAACGACACTTTGCACCTCAC
TGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATCGGTCCCATGATGGAAGACCTGGCAGGGACCTACAGAT
GCTACGGTTCTGTTACTCACTCCCCCATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTCATCACAGGTGAGAGTG
TCCGGACATTCTTCTCATTGTCATTGGGATGCAGAGTGAATGATCCACGACTTGGAACCCCCAGGTAGTTGTAAGGAAGA
TGAGCTTGGTATTCTTATGGAGAGAGACTGACTTGGTGAGGTCTGTACCAACAGAGACAGAGAAACAGGAGACACAAGTA
CAGACCAGGTGTCATAACAGAGGACAGACACAGGGGCCATACCGGGAGTTAGAAAAGACAGAAGGAGTTAAAGGAGACAG
ACAGACAGACATGTCCCAGAGAGAGGTGTCCCTCCATGCTGACTTTGCTCAGAGACCTGGCACAGGTTAGAAGTTTCATT
TCTGTTTTACCTCCACAAAGTGTTCTCTACCAGGAGAACCCAAGGACACCCATATTTCTGACCTGAGTTGGGCCCTGTGG
CCTCAGGCCTTGTGGCACCTACAGATGCCGTGTTTATTCTGACACCTCTGCCTTCCATGTAATGGAGAGTAACCGTCCCA
GGATATCATGGCCCCAGAACACCAACTCCTGTATGCTGTGTGAACTTGTGGTCTCCAGACTGGATTCTGAGGCTCACATT
CCAAATAACCCCACATATGAAAGGATCACTGAGAGGCACAGAGAGAAATCAGGGACACCAAAAAGCAAAGACATAAACAC
ACAGAGAATGAGCCAGAGGAAGGAGATTGAGAGACTCACAGACACATAAAGAGAGAGAAAAGAGGGCAGAGGAGTGGTGA
GAATGATGGAAGGGAGCAGAGAAAAGCACTAAAATTAGACTCCTGAGGGAGAGGCACAAGGACATAGAAAGATGGAGATG
TGGGGATGAATTGCAGAGATTCCAAAGAGAACTAGAGAGACCGAGAGGCAGAGCAAGACAGATGATAGAAGGTTAGATAT
AGATAGATGATAAATAGGTAGATGATAGATAATAGGTTAAAGATACATAGATGATGATTGATTGATTCATTAATAGATGA
GACATAGAGATGATGATGATGAAGACAGATAGATAATACATAGAGATAGAGAGGCAGACAGAAGTCATAGAGAGAGAGAT
GATACATAGATATAGATAACAGATGATTGATGGATAGATAGACAAGTGATAGATACATAGATGATATATAGACATAGATG
ACAGGTAGAGAATTTGTAGATAGGCACCGAATAGATAAATAGATAGATCGATAGATAATAGATAGAAATATGCAGAAAGT
TATGAACAGGACACAAAGTGAGAAACTTAGAATTTAAAAAAGTAACATCAAGTCAACCAATCCAAGGAGAGTCAGAGAGA
ATAAAAGAATCCAAAAAGGGAAAACATATCTAGAGGTGTGGAAGCGAGGTCAGAGACCTAGAGAGACAGAGAAGGTGGAA
GGAGGAAATAGACATGAAGAGAGATGGGGTGGAGGGTGAGAGACAGAGAGAGAGAGCATTAGGTCATAGAGCAGGGGAGT
GAGTTCTCAGCTCAGGTGAAGGGAGCTGTGACAAGGAAGATCCTCCGTAAGGAAAATGCCTCTTCTCCTTCCAGGTCTAT
ATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGG
AGCTCCTATGACATGTACCATCTATCCAGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAACGG
AACATTCCAGGCTGACTTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACTCTC
CCTACGAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTGAGGAAAGCCCATGGCTGTCCCATGTCCTA
TGATCCTAGAGCCTTAGCTGAGGAGCTTCCTGCTGAGGATGGAGAGAAGGATGAACAGATGCAGAGAGAAGACGAAGCTT
GGGTGTGAGGGAGGGATCAGGGCACAGGATGGCAGACAGGGCACCTCCAAACCCTCCTACATGGCCTGCATGAAGGCCTG
CGGCCAGGACTCCAGGCACCCAGGCAGATGGAGAAAGCGGTCAGGAGAGACCCAGAGGAGGGAGACTGGGCTCAGTTTGG
GAAGATCAGAGGTTCCCTCAGCCCCTCAACATTACCCATTTCCCAGAAGCCCATCCTGGCCTCCCACCCACACAGGGATG
TCATCACCTGCAACCCCTACACCCTTTACTTTTGTTTGAGAAATATTTATTGAGGATAAATATACCTATATAGCTTACCA
CCTTTAACATTTTTTTTTTGAGGCGGAGTCTAGCTCTGTCCCCTATGCTGGAGTGCATTGGCACAATCTCAGCTCACTGC
AACTTCCGCCTCCTGGGTTCAAGCGATTCTCTTGCCTCAGCCACCTGAGTAGCTGGTGCTACAGGCGTGCACCACCATGC
CAGGCTACTTTTTGTATTTTTAGTAGAGAGGGGGTTTCACCATGTTGGTCAAGCTGGTCTGGAACTCCTGACCACGTGAT
CCATCCGCATCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCCCAGCCACATTTACCATTTTTAAGTGT
AAAGTCTAGTGGTCATAAATACATTAATATATATATATATACACATATTTTTTTTTACCCTCCACCCTTTTCTTCCTGGC
CTCTGGTAGCCACCATTCTACTCTCTACCTTCATGAGATCCACCTTTTAGCTCCTGTATATGGGTAAGAAATGGGAATCT
TTGTAATGACCTCCAGTTCCATCCATGTGGCTGCAAATATCAGGATGTTTTTCTTTCTATGGAAGAGTAGTCTCCACTAT
GCAAATGTACCACATTCTCTCTATCCATTCACCCACTGATGGGCAGGTAGGTTGACTCCTCATCTTGGCTACTGTGAAGA
GTGCTGCACCAATCATACGAGTGCAGATATCACTTCGATATATTGATTTACTTTCCTTTGGATATAAACCCAGTAGTGAA
ATTGCTGGATACTATGAAAGTTCTCTTTTTAGTTTTTCGTTTGTTGTTTTGTTTTTGTTTTTGAGACAGTTTCCCTCTGT
GCCCAGGCTGGAGTACAAGTGATGTCATCTTGGCTCATTGCAACCTCTGCCTCCTGGGTTCAAATGATTTTCCTGCCTCA
GCCTCCCTAGTATCAGGGATTATAGGCGCACGCCACCATGCCTGGCTACTTTTTGTTTTTTTTAGTATAGATGCGGTTTC
CCCATGTTGGCTGGGCTGCTCTCAAACTCATGACCTCAACTGAGGTGCCCGCCTCGGTCTCCCAAAGTGCCGGGATTACA
GGCATGATCCACCTCACCCAACCTCTTTTTAGTTCTTTAAAGGACTTCCACACTTTTCTCCGTAATGGCTGTACTAATTT
ACACTCCTACCAACAGGATACCAGGATTCTCCTTTCTCTAACACCTTGCCAGCATTTCTTTTGCCTGTCTTGCAGCTAAA
AGCCATTTTATTTTATTTCATTTTATTTTGAGATGGAGTTTCGCTCTTGTCACCCAGGCTGAGTGCAGTGGTGCGATCTC
GGCTCACCACAACCTCCACCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGCACAC
GCCACCACGCCCGACTAATTTTTGTATTTTTAGTAGAGACAGTGTTTCTCCATGTGGCTCAGACTGGTCTCAAACTCCCG
ACCTTATGAGATTCACCCACCTCAGGCTCTCAAAGTTCTAGGATGACAGACGTGAGCCACCACGCCCGGCCTAAAAGCCA
TTTTAATGGGGTGAGATGAAAACTCACTTTGATTTTAATTTGTGTTTCTCTGATGATGAGTGATACTGAGCACTTTTTCG
TATGTGGGGAAATTTCATGTCTTTTGCTCCTTTTTCAATTAAATCATTTGTTTTATTGAGTTGTTTGAGCTTCTTATATT
TCTAGTTATTAATCCCATCTCAGATGCATAGTTTGCACATATTTGCTCCCAATCTGTGGGTTGTCTCTTCACTTTGTTGG
TTTATTTTTAGCGGTGCAGAAGTTGCTTAGTTTGAGGTAATCCCAATGGTCTATTTTTGCTTCGATTACTTGTGTTTTGA
AGGTTTAAAACAAAATGTCTTCCTTCAGACAAACGTCCTGGAGCATTTCCCCAATATTTTCTTCTACGTGTTTCATAGGT
TCAGGCCTTAGACTCACATCTTTAATCCATTTTCATTTGATTTTTGTGTATAGTGACAGGCAGAGGTGCAGTTTCATTCC
TCTGCATGTAGATGTCCAGGTTTCCCTGCACTGTTTATTGAAAAGACTGTCCTTTCCTGATTGTGAGTTCTTGGCACCTT
TGTCAAAGTCCATTGGATGGGCTGGGCATGGTGGCTGACACCTGCAATTTCAGCACTTTGGGAGCCCGAGGTGGGTGGAT
CACCTGAGGCCAAGAGTTCAAGATTAGTCTGGCCAACGTGATGAAACATCGTCTCCACTAAAAATATAAAAATTAGCTGA
GCATGGTGGTCAGCACCTGTAATACCACTACTCAGGAGTTTGAGGCAAGAGAAGTGATTGAACCCAGGAGGCTGTGGTGG
CAGTGAACCGAGATTGCACCTCTGCACTCCAGCCTGGGTGACAGAGCAAGACTCCATCTCAAAAGAAAAACAAAAAATAC
ATTGGAGGTAAATGCATGGATTATATCTGTGTTATTCATTCTGCTCCGTTGTTCTATGTGCCTTTCTTCATGCCAACGTC
ATGCTGTCTTGCTTACTACAGCTCTGTAACATATTTTGAGATCAGGTAGTGTGATGCTCCTGTTTTCTCTTTATACCTTG
AAGTCTCAAGACAGTAGCCGTCACATACAAAAATTACGGAAAAAAGGATCCCAGGACTCCCAGGGCCCAATATTAGATAA
CAGAGTGTTGGCCATGAACCAACCTCAAAGATTTCCACTGAGTAGAGGACAGACACCCTCATTTCCTCACCTCTCTCCTG
TCTCGTGTTCTAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTGAGTACAGAACCCT
CTTATATCCGCTTTTGGAAACCTGGGGAGGTGGAAACCTTGGATTCAGGCGTTGACTCAGCATCTCACAGCTCTGACATT
GTACGCCTGTCTTCTACCATCTCCGAACTCCAGATACTCCAACAGCGAAAGGGATCTGGACCCAAAACAGGGCTCAGTGA
AATCTCTTAATCTCTCATTTTATGGAGCTGAGATCTCCTACAAGCTAGAAAAATGATTGGCAATCTGACATCCTTCTCAG
GAAAAATGCAATGTTTGTTCTGCCTGCATTCCTAACTGGAGGATAAATTCCTGGGGGCTTGAGAGAGGGAAGGGTAGGGA
ACATTTGATGAGGGCAAGGTGTTTTAGAGAAGTTCCACTTGCCCAGGAATGAATTACTGTTGGTCATGAAGCAACCCTGG
CTGACTCAGCAGAGCAAGAGCTTTGCCTTAACAGAGAACGGAGCTCATGCACGCACACTTCGACTCACTGACTCATTCAG
CCACGGCCCCATGCTCAGGCCGTGGAAAAGGCAATTCCCAGCACTGCAGGAGGCCAAGGCGGGTGGATCACTTGAAGTCA
GGAGTTCCAGACCAGCCTGGCCAAAATGGTGAAACCCTGTCTCTATGAAAAATACAAAAATTAGCCGAGCATGGTGGTGC
ATCCCTGTAATCCCAGCTCCTACTCTTGAGGATGAAGCAGGAGAACAACTTCAACCCAGGAGGTGGAGGTTGCAGTGAGT
GGAGATTGCATCACTGCACTCCAGCCTGGGTGACACAAGGAGACTCCGTCTCAAAAAATAAAAATAAGAAATGCATAAAT
ATAATAAAACACACACGAATGACAAAGGCACCTGAATTCCAATCATCATTTTTCTATTTCTCTATAATTACTTCTTTGAT
CCTTTGTCTTATCCATTAGGCAATGAGCCTAAAACCTCTTCCGTATTTGGCTTTCTGTGAGCATGAGACCATATAGAAAA
TGTGAAAGCCCGCTGAATCCTCCAGCACAGATCGTGGAATAGAGAAAGTGCTCTGTTCATCACAAAAAAAACTTGCCCTC
TCACTCAAATCCCCCACTTCACCCCTACTTCCAATCACCTGTGGAGATTCAGATAGACCATGGGGAGGTAAACATTAATA
CTCCTTGGAGTGAGTCCAGATCTTGGAATGAGAGATCAGCACCAGCACTAGCTCCTGCTCCCCTTTCCTACTAATTCACA
GGAGGACAGGTGGTATTGAAGCAATAGATGGTGGAGGGGGTGGTCCTTCCCCCAGCCTCTCAGGTAGAACAGCAGCCTAA
CATGTGTCTCCCGAGATCACAAAGAGTAGGACGTTTCACAGGGGCTTCAACACGATTTCCTGGCTGTTGGACATAAGATA
ACTCTATTTCGCTTTTTTATCTTGATTTCACTTTTGTTTCCTTTCCTTGGAGAACGCAAGTTGTTTGACTCAAGAATGCT
GTGGATGTAGAAATCCTAAAGCACATTCGCTGTGTGTCAATCCCAGTGCAGTCTTCCCAGAAAAGACCCTAAACACCTCC
TAGACTGCACCTGGGCCTACGCCAATTCCTATCACTCACCGTCACTCCAGGGAGACAGAACACACAGAGAATACGTTACA
TAGGCAGGTTCATTACTAACAGATAAGCAGCGAGTGAAAACAGAAGCCTACATTTCAATGTGAGCCAGTCCCTCAAGGCT
CAGAAAAGCTGCTCGGGACATATGGAGTCACCCCATTTGCAGTGTAGCTGGGGGAAGCCAGAAAGCAGCCCAGCCTGGGT
TTTGTACCCTGGAGCCACAGGAAGCACTCAGCTAAAGCACTGCATGACGTCCTCCTCCAGGAAGAACAGGAAGACAGCCC
AGGCTGCTCTGGGACGTTCCTCCTGATCTCAGGACGTTGCTGTCTTAGTCCATTTTTGTTGCTCTAAAGGAACACTTGAG
CCCGGGCAACTTCTAAAGAAAAGAGATTGGTTTGCCTCACCGTTCTGCAGGCTGTACTGGAAGCATGGCACCAGCATCTA
TTTCTCGTGATGGCCTCAGGCTGCTCCCACTCTGGCAGAAGGGAAGGAGGGTCTGTCTGTGCAGAGACCACAGAGATCAC
ACGGCAAGAGAGGGAGCAAGGGGGAGGGGGAGCGATGGAGCTTCCAAGTTCTTTTGAACAACCAGCTCTCTGGGAACTAA
TAGAGGGGGAACTAGCTAACCCCGTCTCCTTGGGACAGCATTGATCTGTTCATGATGGATCCACCTCCATGACCCAAACA
CCTCTCAAGAGGCCCAACCTCCCACAATGGGGGTGAAATTTCAATGTGAGGTTTGAAGGGGTCAAACATCTCAACTAAAG
TAGTTGTATCCTCAGCACATTCTATGGTTACTTTGAGAGCTATAACTGAGAAAGCAGGAGAAAGCTGGGTCTCCCGCCAT
CTGGGTGCTTGTCCTAAAGAGGTGTTTTACGTGGTTACCTGTCAATCAAGAAATGCGAGACAATTCATAAAGAGGAACTG
CTATGATTAGCTTCTTATTGGTGTCTCATCTTCTTCCAGGTAACCCAAGACACCTGCACGTTCTGATTGGGACCTCAGTG
GTCATCATCCTCTTCATCCTCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCAACAAGAAAAGTAAGTCTCACGAAGG
AGAGGCCAGAGAGCTCAGGGCCATGTGGGGAAGCAGGATGGGAGCACTCAGGTGTGTGTTCCTCACAGGTAGGATGGTCC
CTGGCCCAAGGCAGCAGCCACAGAGGCAGGACTTTCTAGAGAGGGCACCAGACTCCCTGTCCCTGCTTTCAGCTCACAGA
CCGTTGCCTGATTCTGAACTGTATCCTCATGTCCCCTGCAGCCACTCACATCCAGGAGAAGGTTCCATGACAGGCAGAAA
GTGGGAGACAGAATCAATGGGATGGGAACTCAGAGCTATTCATGGGATGGGTCCTTGAGCTCAGAGAGATAGAATGTCTG
AGTCTGCTGTTGGCAACTGAGGGACCTCAGGCACCTATGGCCTCCCCCTGTTTGTTGGTATCTGCTTATGAAATGAGGAC
CCAGAAGTGCCCTCCGAGCTCTTTTGTTGACTTCCGTCTCCTACACATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAA
CAGAACAGCGAATAGCGAGGTAGGTGCTCCTCGGCCCAGCCTCGTGGCTAGTGTTATTCCCAAACAGTCCTGGAAAACGT
GAGCACCCTCCCTCACTCAGCATTTCCCTCTCTCCAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGTACAGT
TGGATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGAGTG
TACACGGAACTTCCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGGAT
CTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCGTGAG
TCTGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCC
CACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCACTTGACCCCTGCCCACCTCTCCA
ACCTTACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAGTTCCAAACATACAAGAGGCTC
CCTCTTAACACGGCACTTAGACACGTCCTGTTCCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGAGTATCTTTCAGCC
TTCTGTCAGCAGTAAAACTTATATATTTTTTAAAATAATTTCAATGTAGTTTTCCCTCCTTCAAATAAACATGTCTGCCC
TCAT

IPD-KIR