Allele Report for V*01:01:01:03

V*01:01:01:03 View HGVS Report
Pre-2010 Nomenclature: V*01010103 Local Names: HLA-V*QBL
IMGT/HLA Acc No: HLA02803 OMIM Entry: Not Listed
Assigned: 2007-01-28 Sequence Last Modified: 2007-07-09
Source Entries: AL844851  
Cells Sequence Derived From: QBL  
Known Ethnic Origin Of Source: Caucasoid
Publications
Traherne JA et al. PLoS Genetics 2:81-92 2006. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (517 bps)
ATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCCAGACCTGGGCAGGCTTCCAC
TCCTTGAGGTATTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGA
CACGCAGTGCGTGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGGAGGGGCCGGAATATTGGGAAGAGGAGA
CAGGGACCGCCAAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGCTACTACAACCAGAGTGAGGCC
TGGTCTCACACCCATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTACTCCGCGGGTATCACCAGCTTG
CTTACGATGGCAAGGATTCCATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCAGACACGGCGGCTCAGATCACC
CAGCTCAAGTGGGAGGCGGCCCGGGGGGCGGAGGTTC
Genomic Sequence Data (1883 bps)
CCCTGGAGTGATTTTTCTTCTAGAAGAGTCCACGGGGACAGGTAAGGAGTAGGAGGCAGGGAGTCCAGTTCTGGGACGGG
GATTCCGTGATGCAAAGTGAAGAGAGAGGAACGGGGCCCATTTCGAGGGTTTCTCCCTGGTTTCTCAGACAGCTCCTGGG
CCAAGACTCGGAAACGTTGAGACAGAGCGCTTGGCACAGAAGTAGCGGGGTCAGGGCGAAGTCCCAGGGCCTCAGGCATG
GCTCTCAGGATCTCAGGCCCCAAAGGCGGTGTATGGATTGGGGAGGCCCAGCGCTGGGGATTCCCCATCTCCGCAGGGTT
TCTCTTCTCCCTCTCCCAACCTGTGTCGGGTCCTTCTTCCTGGATACTCACCAGGCTGCCCCAGTTCTCACTCCCATTGA
GTGTCGGGTTCCTAGAGAAGCCAATCAATGTAGCCGCGGTCCCGGTTCTAAAGTTCCCACGCACCCACCGGGACTCCGAT
TCTCCCCAGTCGCCGAGGATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCCAG
ACCTGGGCAGGTGAGTGCGGGGTCGGGAGGGAAACGGCCTCTGTGGGGAGTAGCTAGGGGCCTGCCCGGCGGGGGCTCAG
GAACCCGGTTGCGGTGCCGGGAGGAGGGTCGGGAGAGTCTCAGCCCCCTCCTTGCTCCCAGGCTTCCACTCCTTGAGGTA
TTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGACACGCAGTGCG
TGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGGAGGGGCCGGAATATTGGGAAGAGGAGACAGGGACCGCC
AAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGCTACTACAACCAGAGTGAGGCCTGTGAGTGACA
CCGGCCGGGGGCGCAGATCACTACCCCTCTACATCCCCCACGGACCGCCCGGGTCTCCCCGAGTCTCTGGGTCCGAGATC
CACGCCGAGGCAGCGGAACCTGGAGACCCTTTACCCGGGAGAGGCCCAGGAGCCGTTACCCGGTTTCATTTTCAGCCAAA
ATCCCCGCAGGTTGGTCCTGGCGGGGGCGGGGCTCGGTGGGCGGGGCTGGCCGCGGGGGCGGGGCCAGGGTCTCACACCC
ATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTACTCCGCGGGTATCACCAGCTTGCTTACGATGGCAA
GGATTCCATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCAGACACGGCGGCTCAGATCACCCAGCTCAAGTGGG
AGGCGGCCCGGGGGGCGGAGGTTCATCCTCACAGGGATAGGCACCTATTAGATGTGGTGTGGTTTTCCTCTCTACTCTTA
GACCCTCAGCCAGTATCACTATTGGCATTCCTGAGCCACTGGCTCAGAATTTCAGTACATTATCTGCCCGCGGGACACAC
CTCAGAGGGAAGGGGATGAAGCGTGGGCCATGATGACCATGGAATCCCCTGGTCTTATCACCACCTGCACCTCCCAGGGG
CTGCCAGCCACACAGAGTCATGGACAGGTCTCTACAGACACAACTTAGTGCCAGCTTGGATGAAACCCTCTGAGGAATGG
CTGCCATCTTTCAGGATGTGGTGCATGTATTGAATCAAAGATGTCTCTATAGTGCTGTGTTTACAGAAGGAAGAATACGT
GGGTCCAAAAACCAAGAAGTAGAAGCAGGTGTGGCTCCATATCTAAACCCTTATATTCACCTTCAGGGTGATTTTGCACT
TCTCATCTCCAATATCTGGGCTCTGTAGGGGAGGAGGTCCTGG

IMGT/HLA

Sponsors

Animated Sponsors Logo