Allele Report for V*01:01:01:02

V*01:01:01:02 View HGVS Report
Pre-2010 Nomenclature: V*01010102 Local Names: HLA-V,COX
IMGT/HLA Acc No: HLA02802 OMIM Entry: Not Listed
Assigned: 2007-01-28 Sequence Last Modified: 2007-07-09
Source Entries: AB023058 , AL671561 , BA000025 , CR925767  
Cells Sequence Derived From: APD , COX , RPCI5  
Known Ethnic Origin Of Source: Caucasoid
Publications
Shiina T et al. Proc Natl Acad Sci U S A 96:13282-7 1999. (View abstract)
Stewart CA et al. Genome Res 14:1176-87 2004. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 3 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (517 bps)
ATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCCAGACCTGGGCAGGCTTCCAC
TCCTTGAGGTATTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGA
CACGCAGTGCGTGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGGAGGGGCCGGAATATTGGGAAGAGGAGA
CAGGGACCGCCAAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGCTACTACAACCAGAGTGAGGCC
TGGTCTCACACCCATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTACTCCGCGGGTATCACCAGCTTG
CTTACGATGGCAAGGATTCCATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCAGACACGGCGGCTCAGATCACC
CAGCTCAAGTGGGAGGCGGCCCGGGGGGCGGAGGTTC
Genomic Sequence Data (1883 bps)
CCCTGGAGTGATTTTTCTTCTAGAAGAGTCCACGGGGACAGGTAAGGAGTAGGAGGCAGGGAGTCCAGTTCTGGGACGGG
GATTCCGTGATGCAAAGTGAAGAGAGAGGAACGGGGCCCATTTCGAGGGTTTCTCCCTGGTTTCTCAGACAGCTCCTGGG
CCAAGACTCGGAAACGTTGAGACAGAGCGCTTGGCACAGAAGTAGCGGGGTCAGGGCGAAGTCCCAGGGCCTCAGGCATG
GCTCTCAGGATCTCAGGCCCCAAAGGCGGTGTATGGATTGGGGAGGCCCAGCGCTGGGGATTCCCCATCTCCGCAGGGTT
TCTCTTCTCCCTCTCCCAACCTGTGTCGGGTCCTTCTTCCTGGATACTCACCAGGCTGCCCCAGTTCTCACTCCCATTGA
GTGTCGGGTTCCTAGAGAAGCCAATCAATGTAGCCGCGGTCCCGGTTCTAAAGTTCCCACGCACCCACCGGGACTCCGAT
TCTCCCCAGTCGCCGAGGATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCCAG
ACCTGGGCAGGTGAGTGCGGGGTCGGGAGGGAAACGGCCTCTGTGGGGAGTAGCTAGGGGCCTGCCCGGCGGGGGCGCAG
GAACCCGGTTGCGGTGCCGGGAGGAGGGTCGGGAGAGTCTCAGCCCCCTCCTTGCTCCCAGGCTTCCACTCCTTGAGGTA
TTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGACACGCAGTGCG
TGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGGAGGGGCCGGAATATTGGGAAGAGGAGACAGGGACCGCC
AAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGCTACTACAACCAGAGTGAGGCCTGTGAGTGACA
CCGGCCGGGGGCGCAGATCACTACCCCTCTACATCCCCCACGGACCGCCCGGGTCTCCCCGAGTCTCTGGGTCCGAGATC
CACGCCGAGGCAGCGGAACCTGGAGACCCTTTACCCGGGAGAGGCCCAGGAGCCGTTACCCGGTTTCATTTTCAGCCAAA
ATCCCCGCAGGTTGGTCCTGGCGGGGGCGGGGCTCGGTGGGCGGGGCTGGCCGCGGGGGCGGGGCCAGGGTCTCACACCC
ATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTACTCCGCGGGTATCACCAGCTTGCTTACGATGGCAA
GGATTCCATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCAGACACGGCGGCTCAGATCACCCAGCTCAAGTGGG
AGGCGGCCCGGGGGGCGGAGGTTCATCCTCACAGGGATAGGCACCTATTAGATGTGGTGTGGTTTTCCTCTCTACTCTTA
GACCCTCAGCCAGTATCACTATTGGCATTCCTGAGCCACTGGCTCAGAATTTCAGTACATTATCTGCCCGCGGGACACAC
CTCAGAGGGAAGGGGATGAAGCGTGGGCCATGATGACCATGGAATCCCCTGGTCTTATCACCACCTGCACCTCCCAGGGG
CTGCCAGCCACACAGAGTCATGGACAGGTCTCTACAGACACAACTTAGTGCCAGCTTGGATGAAACCCTCTGAGGAATGG
CTGCCATCTTTCAGGATGTGGTGCATGTATTGAATCAAAGATGTCTCTATAGTGCTGTGTTTACAGAAGGAAGAATACGT
GGGTCCAAAAACCAAGAAGTAGAAGCAGGTGTGGCTCCATATCTAAACCCTTATATTCACCTTCAGGGTGATTTTGCACT
TCTCATCTCCAATATCTGGGCTCTGTAGGGGAGGAGGTCCTGG

IMGT/HLA

Sponsors

Animated Sponsors Logo