Allele Report for V*01:01:01:01

V*01:01:01:01 View HGVS Report
Pre-2010 Nomenclature: V*01010101 Local Names: HLA-V,PGF
IMGT/HLA Acc No: HLA02801 OMIM Entry: Not Listed
Assigned: 2007-01-28 Sequence Last Modified: 2007-07-09
Source Entries: AC004192 , AF055066 , AL022723 , AL645939 , BX005428 , BX927182 , CR759769 , CR788234  
Cells Sequence Derived From: BOLETH , CGM1 , DBB , MLF , MOU , PGF , RPCI-3 , SSTO  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Not defined
Publications
Hampe A et al. DNA Seq 10:263-99 1999. (View abstract)
Stewart CA et al. Genome Res 14:1176-87 2004. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 8 Laboratories: 3
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (538 bps)
ATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCCAGACCTGGGCAGGCTTCCAC
TCCTTGAGGTATTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGA
CACGCAGTGCGTGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGC
CGGAATATTGGGAAGAGGAGACAGGGACCGCCAAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGC
TACTACAACCAGAGTGAGGCCTGGTCTCACACCCATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTAC
TCCGCGGGTATCACCAGCTTGCTTACGATGGCAAGGATTACATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCA
GACACGGCGGCTCAGATCACCCAGCTCAAGTGGGAGGCGGCCCGGGGGGCGGAGGTTC
Genomic Sequence Data (1903 bps)
CCCTGGGGTGATTTTTCTTCTAGAAGAGTCCACGGGGACAGGTAAGGAGTAGGAGGCAGGGAGTCCAGTTCTGGGACGGG
GATTCCGTGATGCAAAGTGAAGAGAGAGGGACGGGGCCCATTCCGAGGGTTTCTCCCTGGTTTCTCAGACAGCTCCTGGG
CCAAGACTCAGGGAAACATTGAGACAGAGCGCTTGGCACAGAAGTAGCGGGGTCAGGGCGAAGTCCCAGGGCCTCAGGCG
TGGCTCTCAGGATCTCAGGCCCCAAAGGCGGTGTATGGATTGGGGAGGCCCAGCGCTGGGCATTCCCCATCTTTGCAGGG
TTTCTCTTCTCCCTCTCCCAACCTGTGTCGGGTCCTTCTTCCTGGGTACTCACCGGGCTGCCCCAGTTCTCACTCCCATT
GAGTGTCGGGTTTCTAGAGAAGCCAATCAATGTAGCCGCGGTCCCGGTTCTAAAGTTCCCACGCACCCACCGGGACTCCG
ATTCTTCCCAGTCGCCGAGGATGGTGTCATGGCGCCCCGAACCCTGCTTCTGCTGCTCTCGGGGGCCCTGGTCCTGACCC
AGACCTGGGCAGGTGAGTGCGGGGTCGGGAGGGAAACGGCGTCTGTGGGGAGTAGCTAGGGGCCTGCCCGGCGGGGGCGC
AGGAACCCGGTTGCGGTGCCGGGAGGAGGGTCGGGAGGGTCTCAGCCCCCTCCTTGCTCCCAGGCTTCCACTCCTTGAGG
TATTTCCACACCACCATGTCCCGGCCCGGCCGCGCGGATCCCCGCTTCCTCTCCGTGGGCGACGTGGACGACACGCAGTG
CGTGCGGCTCGACAGCGACGCCACGAGTCCCAGGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGCCGGAATATT
GGGAAGAGGAGACAGGGACCGCCAAGGCCAAAGCACAGTTTTACCGAGTGAACCTGCGGACCCTGAGCGGCTACTACAAC
CAGAGTGAGGCCTGTGAGTGACACCGGCCGGGGGCGCAGGTCACTACCCCTCCACATCCCCCACGGACCGCCCGGGTCTC
CCCGAGTCTCTGGGTCCGAGATCCACGCCGAGGCAGCGGGACCTGGAGACCCTTGACCCGGGAGAGGCCCAGGAGCCGTT
ACCCGGTTTCATTTTCAGCCAAAATCCCCGCAGGTTGGTCCTGGCGAGGGCGGGGCTCGGTGGGCGGGGCTGGCCGCGGG
GGCGGGGCCAGGGTCTCACACCCATCTAGAGGATGTCTGTCTGCGACGTGGGGTCGGACGGGCGCCTACTCCGCGGGTAT
CACCAGCTTGCTTACGATGGCAAGGATTACATCGTCCTGAACGAGGACCTGTGCTCCTTGACAGCCGCAGACACGGCGGC
TCAGATCACCCAGCTCAAGTGGGAGGCGGCCCGGGGGGCGGAGGTTCATCCTCACAGGGATAGGCACCTATTAGATGTGG
TGTGGTTTTCCTCTCTACTCTTAGACCCTCAGCCAGTATCACTATTGGCATTCCTGAGCCACTGGCTCAGAATTTCAGTA
CATTATCTGCCCGCGGGACACACCTCAGAGGAAAGGGGATGAAGCGTGGTCCATGACCATGGCACCCCCTGGTCTTATCA
CCACCTGCACCTCCCAGGGGCTGCCAGCCACACAGAGTCATGGACAGGTCTCTACAGACACAACTTAGTGCCAGCTTGGA
TGAAACCCTCTGAGGAATGGGTGCCATCTTTCAGGATGTGGTGCATGTATTGAATCAAAGATGTCTCTATAGTGCTGTGT
TTACAGAAGGAAGAATACGTGGGTCCAAAAACCAAGAAGTAGAAGCAGGTGTGGCTCCATATCTAAACCCTTATATTCAC
CTTCAGGGTGATTTTGCACTTCTCATCTCCAATATCTGGGCTCTGTAGGGGAGGAGGTCCTGG

IMGT/HLA

Sponsors

Animated Sponsors Logo