Allele Report for P*02:01:01:01

P*02:01:01:01 View HGVS Report
Pre-2010 Nomenclature: P*02010101 Local Names: HLA-90,MANN
IMGT/HLA Acc No: HLA02744 OMIM Entry: Not Listed
Assigned: 2006-12-27 Sequence Last Modified: 2007-01-12
Source Entries: AC004172 , AC004192 , BX927141 , CR759769 , CR788234  
Cells Sequence Derived From: CGM1 , DBB , MLF , MOU  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 4 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (0 bps)
Genomic Sequence Data (2931 bps)
GTAATTAAATTCTGTACAGGCTCCTGGTTGCAATATACGGTAATACATTGTGCTTTGTATTGAGATGTCCTGGACTCGCA
CACACAAACTCAGAGCTATGAAATAAAGATACTGTAAAAATACAACAGACCAGAGTCACAGATACACAGTCTGGGAAAGT
AAAACTTCACTTTGTGAGTCTAATTGCAATGCGTTTAGACATATTTATATATAATGGGGCCAAAAATCATCTCTTTTACA
AATTAGATTCGTGACCATTCAGGGGCTACCAAGATTGTGCTACCCACTGTAGCACAATCGGAGACCCACGCCGAGGCTGC
GGGACTCGTGGAGACCCTCGACACAAGAACCCCAGGTGCCTATACCCGATTCCATTTTCAGTTCAGGCCCAAATCCCCGG
GGGATTGATCGGGGCAGAGGAGGAGCTCAGTGGCTGAGGCTGACCGCGGGCTTGGGGACAGGGTCTCCCACCTCCAGTGG
ATACACAGCTGCGACCTGGACCCGGACCGGAGCCTCTTCGCGCGGGGATGAACATACCCTACGATGGCGCCAGTTACCTC
GTCCTAAACCAGGAACTGCTCTCTTGGACCGCAGCGGAAAAGGCGGCTCAGATGTTCTGGAGGAGGAACATGCAGAGCTG
CTCAAAACCTACCTGCCGGGAAGGTGGGCGGAGTGGCTCAGCAAAGGCCTTAAGAATGAGAAGGAGAGGCTGCAATGCGC
AGGTACCAGAGGCCACGGGTCGCCTCCCTGATCTCCTGCAGATATCCCTGAGCCACCTTCCAAAAGAAGGGGAGGAAAAT
GGGACCAACGCTAAAATATCCCTCTCCCTCTTGTCCTGAGGCAGAAGAGTCCTCCTGGGTTTCTAAATCCTATACCAGAG
AGTGACTGAGGGCCCGCCCTGCACTCTGGGACAATTAACGGATGAAGTCTCTGCGGGAAAGGAGGGGAAGACAATCCCTG
GAATACTGATACGCGGTCCCCTTTGACCCCCCAGCAGCCTTGGGCACCAGGAATTTTCCTCTCAGGCCTTGTTCTCTGCC
TCATACTCAATGTGTGTGGGGGTCTGATTCCAGCTCTTCTGAGTCCCTCGGCCTCCACTCAGGTCAGGACCAGAAATCTC
TGTTTCCGCCTCAGACACTAGAACTTTCCAAGGAATAAGAGATTATCCCAGGTGCCTGTGTCCAGAATGTTGTCTGGGTT
CTGTGCTCCCTTCCCCACCCCAGATGTCCCATCCATTCTCAGGATGGTCACATGGGTGCTGTGTCTCATGAGGAATGCAA
AGTGCCTGAATTTTCTACCTCTTGCCCTCAGATCCCCTGAAGGCACAGGTAACCCTCCACCCCATCTCCAACTATGAGGC
CACGCTGAGGTGCTGGGCCCTGGGCTTCTACCCTCTGGAGATCACACTGACCCAGGAGCGGGATGGGGAGGACCAAATTC
AGGATGCAGAGTTTGTGGAGACCAGACTTGCAGGGTACAGAACCTTCCAGAAGTGGGCAGCTGCAGTGGTGTCTTCTGGA
GAGAAGCAGAGGTACACATGCCATGTGCAGCACGAGGGGTTGCCTGAGCCCCTCACACTAAGATGGGGTAAGGAGACGAA
TGAGGGGTCATGTCTCTTCTCAGGCAAAGCAGAAGTCCTTCTGGAGCCTTTAAGCAGGGTCAGGGCTGAGGCCTGGGGGT
CAGGGCCCCTCACGTTCACCTCCTTTCTTAGAGCTGTCTTCCCAGCCCATCATCCCCGTTGTGGGCATCATTGCTGGCCT
GGTTCTTCTAGTTGCTGTAATCACTGTAGCTGTGGTCGCTGCTGTGATGTGGAGGAATAAGATCCCAGGTAGGAAAGGGG
TGAGCTCTGAGTTTCCTTCTTCCATTGGTGGATTTCAAGCCCCAGGTAGGAGTAGGCTCATATCTTGCCTAGTTGTGAGG
CACCATCTCCACACACATTTACCCTGTTCAGAGGCCCTGTCTATCAACGCTTACTCTTTTGTAAAGCACTTGTGAAAATG
AAGGACAAATTTATCACCTTGATTGTGGTCATGGGAACCTGACTCCCAGCAGTCACAGGTCAGGGGAAGGTCCCTGCTGA
GGACAGACCTCAGGAGGACAATTGGTCCAGCCTCAACACATCCTCTTCCCTTGGGTTTTCTGATCCTGACCTGGGTCTGT
AGTCACAGTTCTGGAAACTCCTCTAGGATCTCATGCCCTGCCTCCTCCCTGGCCTCTCACAGTTTGTTTTCTTTCCACAG
ATGGAAAAGGAGGCAGTTATGCTCAGGCTTCATGTAAGTGTGGTAGGGGTGGGAAGAGTGATCCCTGAGATCCTTGGGAT
AGTGTAGACAGGAGCCCATGGGGGAGCTCAGCCACCCCAAAATTCCTCCTTTAGTCACATCACCTGTGGGCTCTGACCAG
ATTTTGTTTTTGTTCCACCCCAAACAGGAACAGTACCCAGGGCTCTGATGTGTCTCTCAAGGCTTGTAAAAGTGACACCT
TAGAGGGCCTGAAGTGAAAGAGGAGTTGGGCAGAGGGGACACAACTAAGCTCTGGAGATTCTTTGATTTGGAATTTTTCA
AGGTGTGGTGGGCTGTTCAGTGTCACAACTTACTGTGACTGACCTGGATTAGTTTATGACTATGTTTTTTCTAAGATTGC
CTTGTGAGGGACTGAGATGCAAGATTTGTTCATGCCTCCTCTTTGTGACATTAAGAGCCTCTGGCTTCTCTTTCTGCCAA
AGGGTCTGAATGTGTCTATGTCTACAGTAACAGGTAAGAAATGGGAGACCAGCCCATCCTCATGTCCACCATGACCCCTG
ATATTGTTTGGATCTGTGTCCCCACCCAAATCTCATGTTCAATTGTAATCCCTAATTTTGGAGGTGGTGTCTGGTGGCAG
GTGATCGGCTCATGAGGATGGATCCTTCATGAACGGTTTAGAACCATCTCT

IMGT/HLA

Sponsors

Animated Sponsors Logo