Allele Report for L*01:02

L*01:02 View HGVS Report
Pre-2010 Nomenclature: L*0102 Local Names: HLA-L,CGM1
IMGT/HLA Acc No: HLA02664 OMIM Entry: Not Listed
Assigned: 2006-09-10 Sequence Last Modified: 2006-10-06
Source Entries: AC004191 , BX927189  
Cells Sequence Derived From: CGM1 , MOU  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1094 bps)
ATGGGGGTCATGGCTCCCCGAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCCGGCTCCCA
CTCCTTGAGGTATTTCAGCACCGCAGTGTCCCAGCCCGGCCGCGGGGAGCCCCGGTTCATCGCCGTGGGCTACGTGGACG
ACACAGAGTTCGTGCGGTTCGACAGCGACTCCGTGAGTCCGAGGATGGAGCGGCGGGCGCCGTGGGTGGAGCAGGAGGGG
CTGGAGTATTGGGACCAGGAGACACGGAACGCCAAGGGCCACGCGCAGATTTACCGAGTGAACCTGCGGACCCTGCTCCG
CTATTACAACCAGAGCGAGGCCGGTTCTCACACCATCCAGAGGAAGCATGACTGCGACGTGGGCCCGACAGGCGCCTCCT
CCGCAGGTATGAACAGTTCGCCTACGATGGCAAGGATTACATCGCCCTGAACGAGGACCTGCCCTCCTGGACCGCCGCGA
ACACAGCGGCTCAGATCTCCCAGCACAAGTGGGAAGCGGACAAATACTCAGAGCAGGTCAGGGCCTACCTGAGGGCAAGT
GCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGATCCCCCAAAGGCACATGTGACC
CAGCACCCCGTCTCTGACCATGAGGCCACCCTTGAGGTGCTGGGCCCTGGGCCTCTACCCTGCGGAGATCACACTGACCT
GGCAGCAGGATGGGGAGGACCAGACCCAGGACACGGAGCTTGTGGAGACCAGGCCTGCAGGGGACGGAACCTTCCAGAAG
TGGGTGGCTGTAGTGGTGCCTTCCGGAGAGGAGCAGAGATACATGTGCCATGTGCAGCATGAGGGGCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGTTTCTCCTTGGAGCTG
TGGTCACTGGAGCTGTGGTTGCTGCTGTGATGTAGAGGAAGAAAAGCTCAGATGGAACAAGGAGCTATGCTCGGGCTGCC
TGCAGCAATTGTGCCCAGTACTCTGATGCATCTCATGATACTTGTAAAGCTTGA
Genomic Sequence Data (3684 bps)
GGCGTAGGAAAAGAGAGGTCAGGACAAAGTCCCAGGCCCCAGGCGTGGCTCTCTGGGTCTCAGGCCCCAAGAGCGATGAC
TGCACTGGGGAGTCACAGGGTTGGGGATTGCCCACTCCCCTGAGTTTTGGTTCTCCCAACCTTCATCCTGGATACTTGTG
ACATAATCCCACTTCTCACTCCCATTGGGTGCCGGGTTTTTAGAGAAGCCAATCAGCTTCGCCGCGATCCCGGCACTACG
ATCCCGGCACTACAGTCCCGGCGCAACCACCCGCACTCAGATTCTCCCCAAACGCCAGGGATGGGGGTCATGGCTCCCCG
AACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCCGGTGAGTGCGGGGTCGGGAGGGAAAGGG
CCTCTGCGGGGAGAAGCGAGTGGCCCGCCCGGCCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCTCAGCCTCTCC
TCGCCTCCAGGCTCCCACTCCTTGAGGTATTTCAGCACCGCAGTGTCCCAGCCCGGCCGCGGGGAGCCCCGGTTCATCGC
CGTGGGCTACGTGGACGACACAGAGTTCGTGCGGTTCGACAGCGACTCCGTGAGTCCGAGGATGGAGCGGCGGGCGCCGT
GGGTGGAGCAGGAGGGGCTGGAGTATTGGGACCAGGAGACACGGAACGCCAAGGGCCACGCGCAGATTTACCGAGTGAAC
CTGCGGACCCTGCTCCGCTATTACAACCAGAGCGAGGCCGGTGAGTGACCCTGGCCCGGGGCGCAGGTCACGATCCCTCC
CCATCCCCCACGGACAGCCCAGGTCCCGGGTCTGAGTCTCCGGTCTGAGATCCACCCCGAGGCTGCGGGACCTGCCCAGA
CCCTCGACCAGGGAAGAAACTCGGGCGCCTTTACCCGGTTTAATTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGGG
GCGGGAGCGGGGCTCGGTGTTCGGGGCTGACGGCGGGGGCGAGGCCATGGTTCTCACACCATCCAGAGGAAGCATGACTG
CGACGTGGGCCCGACAGGCGCCTCCTCCGCAGGTATGAACAGTTCGCCTACGATGGCAAGGATTACATCGCCCTGAACGA
GGACCTGCCCTCCTGGACCGCCGCGAACACAGCGGCTCAGATCTCCCAGCACAAGTGGGAAGCGGACAAATACTCAGAGC
AGGTCAGGGCCTACCTGAGGGCAAGTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCG
CGGGTACCAGGGGCCACGGGGCGCCTCCCTCATCTCCTGTAGATTTCCCGGGCTGGCCTCCCACCAGGAGAGTAGGAAAA
TGGGACCAATGCTAGAATATCGCCCTCCCACTGGTCCTGAATGGGAAGAATCCTGGGTTTCCAGATCCTGTACCAGAGAG
TAACTCTGAGAGCCCACCCTGCTCTCTGGGACAATTAAGGGATGAAGTCCCTGAGGAAATGGAGGAGAAGACAGTCCCTG
GAATACTGATCCGTGGTCCCCTTTGACCCCTGCAGCAGCCTGGGGCACCAGGAATTTTCCTCTCAGGCCTTGTTCTCTCC
CTCACACTCATGTGTCCATGGCTCCGATTCCAGCTCTTCTGAGTGCCTTGGCCTCCACTCAGGTCAGGACCAGAAGTCCC
TGCTCCCCCATCAGAGACTCGAACTTTCCAAGGAATAGGAGATTATCCCAGATTCCTGTGTCCAGGCTGGTGTCTGGGTT
CTGTGCTCCCTTCCCTACCCCAGGTGTCCTGTCCATTCTCAGGATGGTCACATGTATGCTGCTGGAGTGTCCTACGAGGA
ATGCAAAGTGCCTGAATTTTCTGACTCTTCCCCTCAGATCCCCCAAAGGCACATGTGACCCAGCACCCCGTCTCTGACCA
TGAGGCCACCCTTGAGGTGCTGGGCCCTGGGCCTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGAC
CAGACCCAGGACACGGAGCTTGTGGAGACCAGGCCTGCAGGGGACGGAACCTTCCAGAAGTGGGTGGCTGTAGTGGTGCC
TTCCGGAGAGGAGCAGAGATACATGTGCCATGTGCAGCATGAGGGGCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAGG
AGGGGTGTAAGTTGTCTATTCTCAGGGAAAGCAGGAGACCTTCGGCAGGGCAGGGCTGAGGCCTGGGGGTCAGAACCCCT
CACCTCCCTCTCCTTTCCCAGAGCCGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGTTTCTCCTT
GGAGCTGTGGTCACTGGAGCTGTGGTTGCTGCTGTGATGTAGAGGAAGAAAAGCTCAGGTAGGGAAGGGGTGAGAGGTGG
GATCTGGGTTTTCTTGTTCCACTGTGGGTTTCAAGCCACAGGTAGAATTGTGACTTGCTTCATCACTGGGAAGCACCGTC
CACACACAGGCCGACCTAGCCTGGGGCCCTGTGTGCCAACACTTGCTCTTTTGTGAAGCACATGTGAAAACGAAGGACAA
ATTTATCACCTTGATGATTGTGGTGATGGGGCCCTCCCAGCAGTCACAGGTCACAAGGGAAGATCCCTACTGAGGACAGA
CCTCAGGAGGGCAGTTGGTCCAGTCCCCACACCTGCTTTCCTCATGTTTCCTGATCCTGCCCTGGGTCTGCAGTCACAGT
TCTGGAAGTTTTCCTGGGGTCCAGGATTTGCTGTTTCCTTAAGGACCTCATGCCCCATGTCCTCCCTGACCTCTCACAGG
TTGTTTTTTTCTCACAGATGGAACAAGGAGCTATGCTCGGGCTGCCTGTTAGTATGGGGGATTAGAGGGCTGCTCCCTGA
GATCATTGGGACAGTGTAGACAAGATTCCTCCTTTAGCCACATCTCCTGTGGGCTCTGACCAGTTCCTATTTTTGTTCTA
CCCCAGGCAGCAATTGTGCCCAGTACTCTGATGCATCTCATGATACTTGTAAAGGTGAGACACGGGGGGGCCTGAAGTGG
GTGGGGGTGAGGCAGAGGGGACATGATTCTGTTGAGGGGTTCTCTGGATTTAGACATCTTGACCATGTGGTAGGCTGTTC
AGAGTGTCACCAGGTACAGTGACTGCCCTGGATTTGTTTATGATTATTTTCTCCTGTAGCTTGAGACAACTGCCTTGAGT
GGGACTGAGAGATACAAAATTTCTTCAGGTCCTTCCTCTGACACACACCATTGTAATTTCAAGAGCTCCTGACTTCTATA
TCTGCACTTGACACGTGAATATATCTATGTGTCTGTGTTCCAGTTAGCATAATGTGAGGAAATGGGCGACTGGTCCACCA
CTGCCACCAGGACCACCACCCCACACTAACCTGTCCTCTCTTCCCCGGTCAAATTTTTTTTCAACAGAGGTGAGGCTGGG
ACATTTCTATTCATGTCTTAACTTTTAAGTTTCACTGAGCTGCCACTTACTCCACTATTCAAAATAAGAACCTGGATATG
AATTTTTCAAATTCTTGCCATGAGGTTGGGTTGATCGTTCAATGAAAGGAGAGCAAGACTCTTAAAACTTGAGAGAGGAA
GTAAAACCTGAGAGCCTTCCAGAATCCATTTTTGCTGTGCTGGGCCTGTTGTAGGTGGAGACAGGAGAGAGAGGGCTGTG
AGGA

IMGT/HLA

Sponsors

Animated Sponsors Logo