Allele Report for L*01:01:01:02

L*01:01:01:02 View HGVS Report
Pre-2010 Nomenclature: L*01010102 Local Names: HLA-L,QBL
IMGT/HLA Acc No: HLA02662 OMIM Entry: Not Listed
Assigned: 2006-09-10 Sequence Last Modified: 2006-10-06
Source Entries: AB014088 , AL844220  
Cells Sequence Derived From: QBL , RPCI5  
Known Ethnic Origin Of Source: Caucasoid
Publications
Traherne JA et al. PLoS Genetics 2:81-92 2006. (View abstract)
Shiina T et al. Proc Natl Acad Sci U S A 96:13282-7 1999. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGGGGTCATGGCTCCCCGAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCCGGCTCCCA
CTCCTTGAGGTATTTCAGCACCGCAGTGTCCCAGCCCGGCCGCGGGGAGCCCCGGTTCATCGCCGTGGGCTACGTGGACG
ACACAGAGTTCGTGCGGTTCGACAGCGACTCCGTGAGTCCGAGGATGGAGCGGCGGGCGCCGTGGGTGGAGCAGGAGGGG
CTGGAGTATTGGGACCAGGAGACACGGAACGCCAAGGGCCACGCGCAGATTTACCGAGTGAACCTGCGGACCCTGCTCCG
CTATTACAACCAGAGCGAGGCCGGTTCTCACACCATCCAGAGGAAGCATGGCTGCGACGTGGGCCCGACAGGCGCCTCCT
CCGCAGGTATGAACAGTTCGCCTACGATGGCAAGGATTACATCGCCCTGAACGAGGACCTGCACTCCTGGACCGCCGCGA
ACACAGCGGCTCAGATCTCCCAGCACAAGTGGGAAGCGGACAAATACTCAGAGCAGGTCAGGGCCTACCTGAGGGCAAGT
GCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCACGCGGATCCCCCAAAGGCACATGTGACC
CAGCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCCTCTACCCTGCGGAGATCACACTGACCTG
GCAGCAGGATGGGGAGGACCAGACCCAGGACACGGAGCTTGTGGAGACCAGGCCTGCAGGGGACGGAACCTTCCAGAAGT
GGGTGGCTGTAGTGGTGCCTTCCGGAGAGGAGCAGAGATACATGTGCCATGTGCAGCATGAGGGGCTGCCAGAGCCCCTC
ACCCTGAGATGGGAGCCGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGTTTCTCCTTGGAGCTGT
GGTCACTGGAGCTGTGGTTGCTGCTGCGATGTGGAGGAAGAAAAGCTCAGATAGAACAAGGAGGAGCTATGCTCGGGCTG
CCTGCAGCAATTGTGCTCAGTACTCTGATGCATCTCATGATACTTGTAAAGCTTGA
Genomic Sequence Data (3770 bps)
GGCGTAGGAAAAGAGAGGTCAGGACAAAGTCCCAGGCCCCAGGCGTGGCTCTCTGGGTCTCAGGCCCCAAGAGCGATGAC
TGCACTGGGGAGTCACAGGGTTGGGGATTGCCCACTCCCCTGAGTTTTGGTTCTCCCAACCTTCTTCCTGGATACTTGTG
ACATAATCCCACTTCTCACTCCCATTGGGTGCCGGGTTTTTAGAGAAGCCAATCAGCTTCGCCGCGATCCCGGCACTAAG
ATCCCGGCACTACAGTCCCGGCGCAACCACCCGCACTCAGATTCTCCCCAAACGCCAAGGATGGGGGTCATGGCTCCCCG
AACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCCGGTGAGTGCGGGGTCGGGAGGGAAAGGG
CCTCTGCGGGGAGAAGCGAGTGGCCCGCCCGGCCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCTCAGCCTCTCC
TCGCCTCCAGGCTCCCACTCCTTGAGGTATTTCAGCACCGCAGTGTCCCAGCCCGGCCGCGGGGAGCCCCGGTTCATCGC
CGTGGGCTACGTGGACGACACAGAGTTCGTGCGGTTCGACAGCGACTCCGTGAGTCCGAGGATGGAGCGGCGGGCGCCGT
GGGTGGAGCAGGAGGGGCTGGAGTATTGGGACCAGGAGACACGGAACGCCAAGGGCCACGCGCAGATTTACCGAGTGAAC
CTGCGGACCCTGCTCCGCTATTACAACCAGAGCGAGGCCGGTGAGTGACCCTGGCCCGGGGCGCAGGTCACGATCCCTCC
CCATCCCCCACGGACAGCCCAGGTCCCGGGTCTGAGTCTCCGGTCTGAGATCCACCCCGAGGCTGCGGGACCTGCCCAGA
CCCTCGACCAGGGAAGAAACTCGGGCGCCTTTACCCGGTTTAATTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGGG
GCGGGAGCGGGGCTCGGTGTTCGGGGCTGACGGCGGGGGCGAGGCCATGGTTCTCACACCATCCAGAGGAAGCATGGCTG
CGACGTGGGCCCGACAGGCGCCTCCTCCGCAGGTATGAACAGTTCGCCTACGATGGCAAGGATTACATCGCCCTGAACGA
GGACCTGCACTCCTGGACCGCCGCGAACACAGCGGCTCAGATCTCCCAGCACAAGTGGGAAGCGGACAAATACTCAGAGC
AGGTCAGGGCCTACCTGAGGGCAAGTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCACG
CGGGTACCAGGGGCCACGGGGGCGCCTCCCTCATTTCCTGTAGATTTCCCGGGCTGGCCTCCCACCAGGAGAGTAGGAAA
ATGGGACCAATGCTAGAATATCGCCCTCCCACTGGTCCTGAATGGGAAGAATCCTGGGTTTCCAGATCCTGTACCAGAGA
GTAACTCTGAGAGCCCACCCTGCTCTCTGGGACAATTAAGGGATGAAGTCCCTGAGGAAATGGAGGAGAAGACAGTCCCT
GGAATACTGATCCGTGGTCCCCTTTGACCCCTGCAGCAGCCTGGGGCACCAGGAATTTTCCTCTCAGGCCTTGTTCTCTC
CCTCACACTCAGTGTGTCCGTGGCTCCGATTCCAGCTCTTCTGAGTGCCTTGGCCTCCACTCAGGTCAGGACCAGAAGTC
CCTGCTCCCCCATCAGAGACTCGAACTTTCCAAGGAATAGGAGATTATCCCAGATTCCTGTGTCCAGGCTGGTGTCTGGG
TTCTGTGCTCCCTTCCCCATCCCAGGTGTCCTGTCCATTCTCAGGATGGTCACATGTATGCTGCTGGAGTGTCCTATGAG
GAATGCAAAGTGCCTGAATTTTCTGACTCTTCCCCTCAGATCCCCCAAAGGCACATGTGACCCAGCACCCCATCTCTGAC
CATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCCTCTACCCTGCGGAGATCACACTGACCTGGCAGCAGGATGGGGAGGA
CCAGACCCAGGACACGGAGCTTGTGGAGACCAGGCCTGCAGGGGACGGAACCTTCCAGAAGTGGGTGGCTGTAGTGGTGC
CTTCCGGAGAGGAGCAGAGATACATGTGCCATGTGCAGCATGAGGGGCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAG
GAGGGGTGTAAGTTGTCTCCTCTCAGGGAAAGCAGGAGACCTTCAGCAGGGCAGGGCTGAGGCCTGGGGGTCAGAACCCC
TCACCTCCCTCTCCTTTCCCAGAGCCGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGTTTCTCCT
TGGAGCTGTGGTCACTGGAGCTGTGGTTGCTGCTGCGATGTGGAGGAAGAAAAGCTCAGGTAGGGAAGGGGTGAGAGGTG
GGGTCTGGGTTTTCTTGTTCCACTGTGGGTTTCAAGCCACAGGTAGAATTGTGACTTGCTTCATCACTGGGAAGCACCGT
CGACACACAGGCCGACCTAGCCTGGGGCCCTGTGTGCCAACACTTGCTCTTTTGTGAAGCACATGTGAAAACGAAGGACA
AATTTATCACCTTGATGATTGTGGTGATGGGGACCTCCCAGCAGTCACAGGTCACAAGGGAAGATCCCTACTGAGGACAG
ACCTCAGGAGGGCAGTTGGTCCAGTCACCACACCTGCTTTCCTCATGTTTCCTGATCCTGCCCTGGGTCTGCAGTCACAG
TTCTGGAAATTTTCCTGGGGTCCAGGATTTGCTGTTTCCTTAAGGACCTCATGCCCCATGTCCTCCCTGACCTCTCACAG
GTTGTTTTTTTCTCACAGATAGAACAAGGAGGAGCTATGCTCGGGCTGCCTGTTAGTATGGGGGATTAGAGGGCTGCTCC
CTGAGATCGTTGGGACAGTGTAGACAAGATTCCTCCTTTAGCCACATCTCCTGTGGGCTCTGACCAGTTCCTATTTTTGT
TCTACCCCAGGCAGCAATTGTGCTCAGTACTCTGATGCATCTCATGATACTTGTAAAGGTGAGACATGGGGGGGCCTGAA
GTGGGTGGGGGTGAGGCAGAGGGGACATGATTCTGTTGAGGGGTTCTCTGGATTTAGACATCTTGACCATGTGGTAGGCT
GTTCAGAGTGTCACCAGGTACAGTGACTGCCCTGGATTTGTTTATGATTATTTTCTCCTGTAGCTTGAGACAACTGCCTT
GAGTGGGACTGAGAGATACAAAATTTCTTCAGGTCCTTCCTCTGACACACACCATTGTAATTTCAAGAGCTCCTGACTTC
TATATCTGCACTTGACACGTGAATATATCTATGTGTCTGTGTTCCAGTTAGCATAATGTGAGGAAATGGGCTACTGGTCC
ACCACTGCCACCAGGACCACCACCCCACACTAACCTGTCCTCTCTTCCCCGGTCAAGTTTTTTTTCAACAGAGGTGAGGC
TGGGACATTTCTATTCATGTCTTAACTTTTAAGTTTCACTGAGCTGCCACTTACTCCACTATTCAAAATAAGAACCTGGA
TATGAATTTTTCAAATTCTTGCCATGAGGTTGGGTTGATTGTTCAATGAAAGGAGAGCAAGACTCTTAAAACTTGAGAGA
GGAAGTAAAACCTGAGAGCCTTCCAGAATCCATTTTTGCTGTGCTGGGCCTGTTGTAGGTGGAGACAGGAGAGAGAGGGC
TGTGAGGAGCTGAGTGTGGACAGCCTATGCTCAGTTCATCATGGAATTTGACGTGGTCATTCATTGGGTTGGTCATCTTC
ACTGCTCCAT

IMGT/HLA

Sponsors

Animated Sponsors Logo