Allele Report for K*01:03

K*01:03 View HGVS Report
Pre-2010 Nomenclature: K*0103 Local Names: HLA-K,CGM1
IMGT/HLA Acc No: HLA02660 OMIM Entry: Not Listed
Assigned: 2006-09-04 Sequence Last Modified: 2006-10-06
Source Entries: AC004203 , AK092921 , CR382333  
Cells Sequence Derived From: CGM1 , MOU , SPLEN2  
Known Ethnic Origin Of Source: Caucasoid
Publications
Yudate HT et al. Nucleic Acids Res 29:185-8 2001. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 3 Laboratories: 3
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1091 bps)
ATGGGGTCATGGCGTCCCAAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTACCCAC
TCCATAAGGTATTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCCCGGTACATCGCAGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCCGCAGGCGCCGTGGTTGGAGCAGGAGGGAC
CGGAGTATTGGGACCGGAGCACACCGAACATCAGGCCCGCGCACAGACTGACAAGAGTGAACCTGCCCATGCCGCGCCGC
TACTACCACCAGAGCTAGGCCGGGTCTAACACCCTCCAGATAATGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCT
CCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATAGCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGG
ACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGAATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACG
TGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCTCACGGACCCCCCCCCCCAAGACACATAT
GATCCACCATTCCGTCTCTGACTATAAGGCCACCCTGAGATGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGA
CCTGGCAGCAGGATGGAGAGGACCAGACTCAGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAAACTTCCAG
AAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCAAGCC
CCTCACCCTGAGATGGAAGCAGTCTTCTCAGCCCACCATCCCCATCGTGGGTATCGTTGCTGGCCTGGTTCTCCTTGGAG
CTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCAGGAAGAACTCAGATAGAGTGAGCTACTCTGAAGCTGCAAGC
AGCAACCATGCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3553 bps)
AGGAGGAGCGGGGTCAGGGCGAAGCCCTATGGCCCCAGGCGTGGCTTTCAGGGTTTCAGGCCCCGAAGGCGTTGTATTGA
TTGGGGAGGCCCAGGGTTGGGGATTCCCCATCTCCGCAGTTTCTCTTCTCCCTCTCCCAACTTATGTAGGGTCCTTCTTC
CTGGACACTCAGGATGTGGACTCAGTTCTCACTCCCATTTGGTGTCGGGTTTCTAGCGAAGCCAATCGGCGTCGCTGGGG
TCCCTGTTCCAGAAGTCCCCGCGAACCCATTGGGATTCAGATTCTCCCCAGACGCCGAGGATGGGGTCATGGCGTCCCAA
ACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTGAGTGCGGGATCCGGAGGGAAATGGC
CTCTGCGGGGAGGAGCTAGGGGCCCGCGCACTGGGGCGCAGGACCCGGGGAGCCGCTCAAGGAGGAGGGTCGGACGGGTC
TCAGCCCCTCCTCGCCCCCAGGTACCCACTCCATAAGGTATTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCC
CGGTACATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCC
GCAGGCGCCGTGGTTGGAGCAGGAGGGACCGGAGTATTGGGACCGGAGCACACCGAACATCAGGCCCGCGCACAGACTGA
CAAGAGTGAACCTGCCCATGCCGCGCCGCTACTACCACCAGAGCTAGGCCGGTGAATGACCCCGGCCTGGGGCGAAGGTC
ACGACCCCTCCTCATCCCCCACGGACGCCCCGGGTCCCCCCCGCGAGTCTCCGGCTCCGAGATCCACCCCGAGGCTGCGG
GACCCGCCAGATCCTCGACCCGGGAGAGGCCCAGGAGCCTTTACCAGGTTTCATTTTCCGTTTAGGCCAAAATCCCCGCG
GGTTGGTCGGGGCGGGGGCGGGGCTCGGTGGGCGGGGCTGACAGCGGGGGCGGGGCCAGGGTCTAACACCCTCCAGATAA
TGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCTCCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATA
GCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGGACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGA
ATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACGTGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGAC
GCTGCAGCTCACGGGTACCAGGGAACACAAGACGTCTCCCTGATCGCCTGTAGATCTCCTGGGCTGGCTTCCCACAAAGA
GAGAAGGAAAATGGGACCAACACTAGAATGTCGTCCTCTCTCTGGTCCTGAGGGAGAGGAATCCTCCTGGGTTTCCAGAT
CCTGTACAAGAGAGTGACTCTGAGGGTCTGCCCTGCTCTCTGATACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGG
AAGACAATCCCTGGAATACTGATGAGGGGTTCCCTTTGACACTGGCAGCAGCCTTGGGCCCCGTTACTTTTCCTCTCAGG
CCTTGCTCTCTGCTTTACACTCAATGTGTGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCA
GGACCAGAAGTCACTGTTCCCTCCTCAGGGACTAGAATTTTCCACGGATAGGAGATTATCCCAGGTACCTGTGTCCAGGT
TGGCGTCTGGGTTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTGTCCATTCTCAGGATGGCCACATGCGTGCTGCTGGAG
TGTCTCATGAGAGATGCAAAGTGCCTGAATTTTCTGACTCTTCCTGTTAGACCCCCCCCCCCAAGACACATATGATCCAC
CATTCCGTCTCTGACTATAAGGCCACCCTGAGATGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGACCTGGCA
GCAGGATGGAGAGGACCAGACTCAGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAAACTTCCAGAAGTGGG
CAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCAAGCCCCTCACC
CTGAGATGGAGTAAGGCAGGAGATGAGTGGAGGGGGGGTCATGTCTCTTAGGGAAAGCAGGAGCCTCTCTGGAGAACTTC
AGCAGGGTCGGTGCTGGGGGCTGAGGGTCAGGGACGCTCACCTTCCCCTTTTTTCCCAGAGCAGTCTTCTCAGCCCACCA
TCCCCATCGTGGGTATCGTTGCTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGC
AGGAAGAACTCAGGTAAGGAATGGATGAGGAGTGGGGTCTGAGATTTCTTGTCCCACTGAGGGTTTCAAGCCCCAGTTAG
AAGTGTGTCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGCCTGCGCCCTGTGTGCCAGCACTT
ACTCTTTTGTAAAGCACCTGTGACAATGAAGGACAGATTTATCACCTTGATGATTATGATGATGGGGACCTGATCCCAGC
AGTCACAAGTCACAGGGGAAGGTCCCTGCTGAGGACAGACCTCAGGAGGGCAGTTGGTTCAGGACCCACACCTGCTTTCC
TCATGTTTCCTGATCCTGTCCTAGATCAGCAGTTACACTTTCAGGAAACTTCTCTAGGATCAAAGGCTAGGGGGTTTGTT
TAGGGCCGTATGGCCCTGACTCCTTTCTGGCCTCTTATAGGACATTTTCTTCCCACAGATAGAGTGAGCTACTCTGAAGC
TGCAAGTAAGTATGAAGTGGGCTGATCCCTGAGATCTTTGGGATATTGTGGTCGGGAGCCCATGGGGGAGCTCACCCAAC
CCCAGATTCCTCCTCTAGCCGCATCTTCTGTGGGCTCTGACCAAGTCCTGTTTTTGTTCTACCCCAGGCAGCAACCATGC
GCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACGCTGGGGGACCTGATGTGTGGGGGGTGTTGGGGGCAAT
AGTGGATGCAGCTGTGCTATGGGGTTTCTTTGAATTGGATGTATTGAACATGTGATGGGCTGTTTAAAGTGTCACCCCTC
ACTGTGACGGATATGAATTTGTTCATGAATATTTTATTTTATAGTGTGAGACAGCTGCCTTCTGTGGGACTGAGAGGCAA
GATTTGTTCACGCCTTCCCTTTGTGACTTCAAAAACCCTGACTCTCTTTCTGCAAAGGCACCTGAATGTGCCTGTGTTCC
TGTAGGCATAATATGAGGAGGTGGGGAGACCAACCCACCCCCATGTCCACCATGACCCTCTTCCCTCATGCTGACCTGTG
TTCCGTCTCCAATAATTAATCATTCCTGCTCCATAGACGTGAGGCTGAGATGTCTCCATCTCTGTCTCAACTTTATGTGC
ACTGAGCTGTAACTTCTTACTTCCTTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo