Allele Report for K*01:02

K*01:02 View HGVS Report
Pre-2010 Nomenclature: K*0102 Local Names: HLA-K,B30H3 YAC,CGM1
IMGT/HLA Acc No: HLA02656 OMIM Entry: Not Listed
Assigned: 2006-09-04 Sequence Last Modified: 2006-10-06
Source Entries: AF055066 , CR388220  
Cells Sequence Derived From: BOLETH , DBB  
Known Ethnic Origin Of Source: Caucasoid
Publications
Hampe A et al. DNA Seq 10:263-99 1999. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1093 bps)
ATGGGGTTATGGCGTCCCGAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTTCCCAC
TCCATAAGGTAGTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCCCGGTACATCGCAGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCCGCAGGCGCCGTGGTTGGAGCAGGAGGGAC
CGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGACAAGAGTGAACCTGCCCATGCCGCGCCGC
TACTACCACCAGAGCTAGGCCGGGTCTAACACCCTCCAGATAATGTATGGCTGCGACTCGGGGCTGGAACGGCGCCTCCT
CCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATAGCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGG
ACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGAATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACG
TGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGATGCTGCAGCTCACGGACACCCCCCCCGCAAGACACATA
TGATCCACCATTCCATCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTATGGAGATCACACTG
AGCTGGCAGCAGGATGAAGAGGACCAGACTCGGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCA
GAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCGAGCCC
CTCACCCTGAGATGGGAGCAGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTACTGGCCTGGTTCTCCTTGGAGC
TGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCAGGAAGAAGAACTCAGATAGAGTGAGCTACTCTGAAGCTGCAA
GCAGCGACCATGCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3555 bps)
AGGAGGAGCGGGGTCAGGGCGAAGTCCTATGGCCCCAGGCGTGGCTCTCAGGGTTTCAGGCCCCGAAGGCGATGTATTGA
TTGGGGAGGCCCAGGGTTGGGGATTCCCCATCTCCGCAGTTTCTCTTCTCCCTCTCCCAACTTATGTAGGGTCCTTCTTC
CTGGACACTCAGGATGTGGACTCAGTTCTCACCCCCATTTGGTGTCGGGTTTCTAGCGAAGCCAATCGGCGTCGCTGGGG
TCCCTGTTCCAGAAGTCCCCGCGAACCCACTGGGACTCAGATTCTCCCCATACGCCGAGGATGGGGTTATGGCGTCCCGA
ACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTGAGTGCGGGATCCGGAGGGAAATGGC
CTCTGCGGGGAGGAGCTAGGGGCCCGCGCACTGGGGCGCAGGACCCGGGGAGCAGCGCAAGGAGGAGGGTCGGATGGGTC
TCAGCCCCTCCTCGCCCCCAGGTTCCCACTCCATAAGGTAGTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCC
CGGTACATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCC
GCAGGCGCCGTGGTTGGAGCAGGAGGGACCGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGA
CAAGAGTGAACCTGCCCATGCCGCGCCGCTACTACCACCAGAGCTAGGCCGGTGAATGACCCCGGCCTGGGGCGAAGGTC
ACGACCCCTCCTCATCCCCCACGGACGTCCCGGGTCCCCCCCGCGAGTCTCCGGCTCCGAGACCCACCCCGAGGCTGCGG
GACCCGCCAGATCCTCGACCCGGGAGAGGCCCAGGCGCCTTTACCAGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCG
GGTTGGTCGGGGCGGGGGCGGGGCTCGGTGGGCGGGGCTGACAGCGGGGGCGGGGCCAGGGTCTAACACCCTCCAGATAA
TGTATGGCTGCGACTCGGGGCTGGAACGGCGCCTCCTCCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATA
GCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGGACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGA
ATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACGTGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGAT
GCTGCAGCTCACGGGTACCAGGGAACACAAGACGTCTCCCTGATCGCCTGTAGATCTCCTGGGCTGGCTTCCCACAAAGA
GAGAAGGAAAATGGGACCAACACTAGAATGTCGTCCTCTCTCTGGTCCTGAGGGAGAGGAATCCTCCTGGGTTTCCAGAT
CCTGTACAAGAGAGTGACTCTGAGGGTCTGCCCTGCTCTCTGATACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGG
AAGACAATCCCTGGAATACTGATGAGGGGTTCCCTTTGACACCAGCAGCAGCCTTGGGCCCCGTTACTTTTCCTCTCAGG
CCTTGTTCTCTGCTTTACACTCAATGTGTGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTGCACTCAGGTCA
GGACCAGAAGTCACTGTTCCCTCCTCAGGGACTAGAATTTTCCACGGATAGGAGATTATCCCAGGTACCTGTGTCCAGGC
TGGTGTCTGGGTTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTGTCCATTCTCAGGATGGCCACATGCGTGCTGCTGGAG
TGTCTCATGAGAGATGCAAAGTGCCTGAATTTTCTGACTCTTCCTGTTAGACACCCCCCCCGCAAGACACATATGATCCA
CCATTCCATCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTATGGAGATCACACTGAGCTGGC
AGCAGGATGAAGAGGACCAGACTCGGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGG
GCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCGAGCCCCTCACCC
TGAGATGGGGTAAGGCAAGAGATTAGTGGAGGGGGGGTCATGTCTCTTAGGTAAAGCAGGAGCCTCTCTGGAGAACTTCA
GCAGGGTCGGTGCTGGGGGCTGAGGGTCAGGGACGCTCACCTTCCCCTTTTTTCCCAGAGCAGTCTTCTCAGCCCACCAT
CCCCATCGTGGGCATCGTTACTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCA
GGAAGAAGAACTCAGGTAAGGAATGGATGAGGAGTGGGGTCTGAGATTTCTTGTCCCACTGAGGGTTTCAAGCCCCAGTT
AGAAGTGTGTCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGCCTGGGCCCTCTGTGCCAGCAC
TTACTCTTTTGTAAAGCACCTGTGACACTGAAGGACAGATTTATCACCTTGATGATTATGATGATGGGGACCTGATCCCA
GCAGTCACAAGTCACAGGGGAAGGTCCCTGCTGAGGACAGACCTCAGGAGGGCAGTTGGTCCAGGACCCACACCTGCTTT
CCTTATGTTTCCTGATCCTGTCCTGGATCAGCAGTTACACTTTCAGGAAACTTCTCTGGGATCAAAGGCTAGGGGGTTTG
TTTAGGGCCGTATGGCCCTGACTCCTTTCTGGCCTCTCATAGGACATTTTCTTCCCACAGATAGAGTGAGCTACTCTGAA
GCTGCAAGTAAGTATGAAGTGGGCTGATCCCTGAGATCCTTGGGATATTGTGGTCGGGAGCCCATGGGGGAGCTCACCCA
ACCCCAGATTCCTCCTCTAGCCGCATCTCCTCTGGGCTCTGACCAAGTCCTGTTTTTGTTCTACCCCAGGCAGCGACCAT
GCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACGCTGGGGGACCTGATGTGTGGGGGGTGTTGGGGGCA
ATAGTGGATGCAGCTGTGCTATGGGGTTTCTTTGAATTGGATGTATTGAACATGTGATGGGCTGTTTAAAGTGTCATCCC
TCACTGTGACGGATATGAATTTGTTCATGAATATTTTATTTTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGC
AAGATTTGTTCACGCCTTCCCTTTGTGACTTCAAAAACCCTGACTCACTTTCTGCAAAGGCACCTGAATGTGCCTGTGTT
CCTGTAGGCATAATATGAGGAGGTGGGGAGACCAACCCACCCCCATGTCCACCATGATCCTCTTCCCTCATGCTGACCTG
TGTTCCCTCTCCAATAATTAATCATTCCTGCTCCATAGAGGTGAGGCTGAGATGTCTCCATCTCTGTCTCAACTTTATGT
GCACTGAGCTGTAACTTCTTACTTCCCTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo