Allele Report for K*01:01:01:04

K*01:01:01:04 View HGVS Report
Pre-2010 Nomenclature: K*01010104 Local Names: HLA-K,SSTO
IMGT/HLA Acc No: HLA02659 OMIM Entry: Not Listed
Assigned: 2006-09-04 Sequence Last Modified: 2006-10-06
Source Entries: BX005091  
Cells Sequence Derived From: SSTO  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1094 bps)
ATGGGGTCATGGCGTCCCGAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTTCCCAC
TCCATAAGGTAGTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCCCGGTACATCGCAGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCCGCAGGCGCCGTGGTTGGAGCAGGAGGGAC
CGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGACAAGAGTGAACCTGCCCATGCCGCGCCGC
TACTACCACCAGAGCTAGGCCGGGTCTAACAACCTCCAGATAATGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCT
CCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATAGCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGG
ACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGAATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACG
TGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGATGCTGCAGCTCACGGACACCCCCCTCCAAGACACATAT
GATCCACCATTCCATCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGA
GCTGGCAGCAAGATGGAGAGGACCAGACTCGGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAG
AAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCGAGCC
CCTCACCCTGAGATGGGAGCAGTCTTCTCAGCCCACCATCCCCATCGTGGGCATCGTTACTGGCCTGGTTCTCCTTGGAG
CTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCAGGAAGAAGAACTCAGATAGAGTGAGCTACTCTGAAGCTGCA
AGCAGCGACCATGCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3557 bps)
AGGAGGAGCGGGGTCAGGGCGAAGTCCTATGGCCCCAGGCGTGGCTCTCAGGGTTTCAGGCCCCGAAGGCGATGTATTGA
TTGGGGAGGCCCAGGGTTGGGGATTCCCCATCTCCGCAGTTTCTCTTCTCCCTCTCCCAACTTATGTAGGGTCCTTCTTC
CTGGACACTCAGGATGTGGACTCAGTTCTCACCCCCATTTGGTGTCGGGTTTCTAGAGAAGCCAATCGGCGTCGCTGGGG
TCCCTGTTCCAGAAGTCCCCGCGAACCCATTGGGACTCAGATTCTCCCCAGACGCCGAGGATGGGGTCATGGCGTCCCGA
ACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTGAGTGCGGGATCCGGAGGGAAATGGC
CTCTGCGGGGAGGAGCTAGGGGCCCGCGCACTGGGGCGCAGGACCCGGGGAGCAGCGCAAGGAGGAGGGTCGGACGGGTC
TCAGCCCCTCCTCGCCCCCAGGTTCCCACTCCATAAGGTAGTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCC
CGGTACATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCC
GCAGGCGCCGTGGTTGGAGCAGGAGGGACCGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGA
CAAGAGTGAACCTGCCCATGCCGCGCCGCTACTACCACCAGAGCTAGGCCGGTGAATGACCCCGGCCTGGGGCGAAGGTC
ACGACCCCTCCTCATCCCCCACGGACGTCCCGGGTCCCCCCCGCGAGTCTCCGGCTCCGAGATCCACCCCGAGGCTGCGG
GACCCGCCAGATCCTCGACCCGGGAGAGGCCCAGGCGCCTTTACCAGATTTCATTTTCAGTTTAGGCCAAAATCCCCGCG
GGTTGGTCGGGGCAGGGGCGGGGCTCGGTGGGCGGGGTTGACAGCGGGGGCGGGGCCTGGGTCTAACAACCTCCAGATAA
TGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCTCCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATA
GCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGGACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGA
ATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACGTGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGAT
GCTGCAGCTCACGGGTACCAGGGAACACAAGACGTCTCCCTGATCGCCTGTAGATCTCCTGGGCTGGCTTCCCACAAAGA
GAGAAGGAAAATGGGACCAACACTAGAATGTCGTCCTCTCTCTAGTCCTGAGGGAGAGGAATCCTCCTGGGTTTCCAGAT
CCTGTACAAGAGAGTGACTCTGAGGGTCTGCCCTGCTCTCTGATACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGG
AAGACAATCCCTGGAATACTGATGAGGGGTTCCCTTTGACACCAGCAGCAGCCTTGGGCCCCGTTACTTTTCCTCTCAGG
CCTTGTTCTCTGCTTTACACTCAATGTGTGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCATCCACTCAGGTCA
GGACCAGAAGTCACTGTTCCCTCCTCAGGGACTAGAATTTTCCACGGATAGGAGATTATCCCAGGTACCTGTGTCCAGGT
TGGTGTCTGGGTTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTGTCCATTCTCAGGATGGCCACATGCGTGCTGCTGGAG
TGTCTCATGAGAGATGCAAAGTGCCTGAATTTTCTGACTCTTCCTGTTAGACACCCCCCTCCAAGACACATATGATCCAC
CATTCCATCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGAGCTGGCA
GCAAGATGGAGAGGACCAGACTCGGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGG
CAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACATGTGCCATGTGCAGCATGAGGGGTTGCCCGAGCCCCTCACC
CTGAGATGGGGTAAGGCAAGAGATTAGTGGAGGGGGGGGTCATGTCTCTTAGGTAAAGCAGGAGCCTCTCTGGAGAACTT
CAGCAGGGTCGGTGCTGGGGGCTGAGGGTCAGGGACGCTCACCTTCCCCTTTTTTCCCAGAGCAGTCTTCTCAGCCCACC
ATCCCCATCGTGGGCATCGTTACTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTG
CAGGAAGAAGAACTCAGGTAAGGAATGGATGAGGAGTGGGGTCTGAGATTTCTTGTCCCACTGAGGGTTTCAAGCCCCAG
TTAGAAGCGTGTCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGCCTGGGCCCTGTGTGCCAGC
ACTTACTCTTTTGTAAAGCACCTGTGACATTGAAGGACAGATTTATCACCTTGATGATTATGATGATGGGGACCTGATCC
CAGCAGTCACAAGTCACAGGGGAAGGTCCCTGCTGAGGACAGACCTCAGGAGGGCAGTTGGTTCAGGACCCACACCTGCT
TTCCTCATGTTTCCTGATCCTGTCCTAGATCAGCAGTTACACTTTCAGGAAACTTCTCTAGGATCAAAGGCTAGGGGGTT
TGTTTAGGGCCGTATGGCCCTGACTCCTTTCTGGCCTCTTATAGGACATTTTCTTCCCACAGATAGAGTGAGCTACTCTG
AAGCTGCAAGTAAGTATGAAGTGGGCTGATCCCTGAGATCTTTGGGATATTGTGGTCGGGAGCCCATGGGGGAGCTCACC
CAACCCCAGATTCCTCCTCTAGCCGCATCTCCTGTGGGCTCTGACCAAGTCCTGTTTTTGTTCTACCCCAGGCAGCGACC
ATGCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACGCTGGGGGACCTGATGTGTGGGGGGTGTTGGGGG
CAATAGTGGATGCAGCTGTGCTATGGGGTTTCTTTGAATTGGATGTATTGAACATGTGATGGGCTGTTTAAAGTGTCATC
CCTCACTGTGACGGATATGAATTTGTTCATGAATATTTTATTTTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAG
GCAAGATTTGTTCACGCCTTCCCTTTGTGACTTCAAAAACCCTGACTCTCTTTCTGCAAAGGCACCTGAATGTGCCTGTG
TTCCTGTAGGCATAATATGAGGAGGTGGGGAGACCAACCCACCCCCATGTCCACCATGACCCTCTTCCCTCATGCTGACC
TGTGTTCCCTCTCCAATAATTAATCATTCCTGCTCCATAGAGGTGAGGCTGAGATGTCTCCATCTCTGTCTCAACTTTAT
GTGCACTGAGCTGTAACTTCTTACTTCCCTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo