Allele Report for K*01:01:01:01

K*01:01:01:01 View HGVS Report
Pre-2010 Nomenclature: K*01010101 Local Names: HLA-K,RPCI-5,544A6
IMGT/HLA Acc No: HLA02654 OMIM Entry: Not Listed
Assigned: 2006-09-04 Sequence Last Modified: 2006-10-06
Source Entries: AB023056 , AL671277  
Alignment of CDS Source Entries
K*01:01:01:01
K*01:01:01:01
Submission 1
Submission 2

Locus Reference
  Virtual entry for K*01:01:01:01 
  Individual submission(s) 
Cells Sequence Derived From: PGF , RPCI5  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Not defined
ISO OID: 2.16.840.1.113883.13.252 (HL7 Registered Organisational OID)
2.16.840.1.113883.13.252.1.1.2654 (Allele OID)
Publications
Shiina T et al. Proc Natl Acad Sci U S A 96:13282-7 1999. (View abstract)
Stewart CA et al. Genome Res 14:1176-87 2004. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1092 bps)
ATGGGGTCATGGCGTCCCGAACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTACCCAC
TCCATAAGGTATTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCCCGGTACATCGCAGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCCGCAGTCGCCGTGGTTGGAGCAGGAGGGAC
CGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGACAAGAGTGAACCTGCCCATGCCGCGCCGC
TACTACCACCAGAGCTAGGCCGGGTCTAACACCCTCCAGATAATGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCT
CCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATAGCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGG
ACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGAATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACG
TGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCTCACGGACCTCTCCCCCAGACACATATGA
TCCACCATTCCGTCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGGCC
TGGCAGCAGGATGGAGAGGACCAGACTCGGGACATGGAGCTTCTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAA
GTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACCCGTGCCATGTGCAGCATGAGGGGTTGCCCAAGCCCC
TCACCCTGAGATGGGAGCAGTCTTCTCAGCCCACCATCCCCATCGTGGGTATCGTTGCTGGCCTGGTTCTCCTTGGAGCT
GTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCAGGAAGAAGAACTCAGATAGAGTGAGCTACTCTGAAGCTGCAAG
CAGCGACCATGCGCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3552 bps)
AGGAGGAGCGGGGTCAGGGCGAAGTCCTATGGCCCCAGGCGTGGCTCTCAGGGTTTCAGGCCCCGAAGGCGATGTATTGA
TTGGGGAGGCCCAGGGTTGGGGATTCCCCATCTCCGCAGTTTCTCTTCTCCCTCTCCCAACTTATGTAGGGTCCTTCTTC
CTGGACACTCAGGATGTGGACTCAGTTCTCACCCCCATTTGGTGTCGGGTTTCTAGCGAAGCCAATCGGCGTCGCTGGGG
TCCCTGTTCCAGAAGTCCCCGCGAACCCATTGGGACTCAGATTCTCCCCAGACGCCGAGGATGGGGTCATGGCGTCCCGA
ACCCTCCTCCTGCTGCTCTTGGGGGCCCTGGCCCTGACCGAGACCTGGGCGGGTGAGTGCGGGATCCGGAGGGAAATGGC
CTCTGCGGGGAGGAGGTAGGGGCCCGCGCACTGGGGCGCAGGACCCGGGGAGCAGCGCAAGGAGGAGGGTCGGACGGGTC
TCAGCCCCTCCTCGCCCCCAGGTACCCACTCCATAAGGTATTTCAGCACCGCCGTGTCCCGGCCGGGTCGCGGGGAGCCC
CGGTACATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCGGCGACTCCGAGGATGTAGCC
GCAGTCGCCGTGGTTGGAGCAGGAGGGACCGGAGTATTGGGACCGGAGCACACGGAACATCAGGCCCGCGCACAGACTGA
CAAGAGTGAACCTGCCCATGCCGCGCCGCTACTACCACCAGAGCTAGGCCGGTGAATGACCCCGGCCTGGGGCGAAGGTC
ACGACCCCTCCTCATCCCCCACGGACGTCCCGGGTCCCCCCCGCGAGTCTCCGGCTCCAAGATCCACCCCGAGGCTGCGG
GACCCGCCAGATCCTCGACCCGGGAGAGGCCCAGGCGCCTTTACCAGGTTTCATTTTCCGTTTAGGCCAAAATCCCCGCG
GGTTGGTCGGGGCGGGGGCGGGGCTCGGTGGGCGGGGCTGACCGCGGGGGCGGGGCCAGGGTCTAACACCCTCCAGATAA
TGTATGGCTGCGACTTGGGGCTGGAAGGGCGCCTCCTCCGCGGGTATGAACAGCACGCCAACGATGGCAAGGATTACATA
GCCCGGAACTAGGACCTGCGCTCCTGGACCGCGGCGGACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCAGAAGA
ATTTGCAGAGCAGATCAGGGCCTACCTGGAGGGCACGTGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGAC
GCTGCAGCTCACGGGTACCAGGGAACACAAGACGCCTCCCTGATCGCCTGTAGATCTCCTGGGCTGGCTTCCCACAAAGA
GAGAAGGAAAATGGGACCAACACTAGAATGTCGTCCTCTCTCTGGTCCTGAGGGAGAGGAATCCTCCTGGGTTTCCAGAT
CCTGTACAAGAGAGTGACTCTGAGGGTCTGCCCTGCTCTCTGATACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGG
AAGACAATCCCTGGAATACTGATGAGGGGTTCCCTTTGACACCAGCAGCAGCCTTGGGCCCCGTTACTTTTCCCCTCAGG
CCTTGTTCTCTGCTTTACACTCAATGTGTGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCA
GGACCAGAAGTCACTGTTCCCTCCTCAGGGACTGGAATTTTCCACGGAATTCGGAGATTATCCCAGATACCTGTGTCCAG
GTTGGTGTCTGGGTTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTGTCCATTCTCAGGATGGCCACATGCGTGCTGCTGG
AGTGTCTCATGAGAGATGCAAAGTGCCTGAATTTTCTGACACTTCCTGTTAGACCTCTCCCCCAGACACATATGATCCAC
CATTCCGTCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGTGGAGATCACACTGGCCTGGCA
GCAGGATGGAGAGGACCAGACTCGGGACATGGAGCTTCTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGG
CAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATACCCGTGCCATGTGCAGCATGAGGGGTTGCCCAAGCCCCTCACC
CTGAGATGGGGTAAGGCAGGAGATGAGTGGAGGGGGGGTCATGTCTCTTAGGAAAGCAGGAGCCTCTCTGGAGAACTTCA
GCAGGGTCGGTGCTGGGGGCTGAGGGTCAGGGACGCTCACCTTCCCCTTTTTTCCCAGAGCAGTCTTCTCAGCCCACCAT
CCCCATCGTGGGTATCGTTGCTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGAGCTGTGGTTTCTGCTGTGATGTGCA
GGAAGAAGAACTCAGGTAAGGAATGGATGAGGAGTGGGGTCTGAGATTTCTTGTCCCACTGAGGGTTTCAAGCCCCAGTT
AGAAGTGTGTCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGCCTGGGCCCTGTGTGCCAGCAC
TTACTCTTTTGTAAAGCACCTGTGACAATGAAGGACAGATTTATCACCTTGATGATTATGATGATGGGGACCTGATCCCA
GCAGTCACAAGTCACAGGGGAAGGTCCCTGCTGAGGACAGACCTCAGGAGGGCAGTTGGTCCAGGACCCACACCTGCTTT
CCTCATGTTTCCTGATCCTGTCCTAGATCAGCAGTTACACTTTCAGGAAACTTCTCTGGGATCAAAGGCTAGGGGGTTTG
TTTAGGGCCGTATGGCCCTGACTCCTTTCTGGCCTCTCATAGGACATTTTCTTCCCACAGATAGAGTGAGCTACTCTGAA
GCTGCAAGTAAGTATGAAGTGGGCTGATCCCTGATCCTTGGGATATTGTGGTCGGGAGCCCATGGGGGAGCTCACCCAAC
CCCAGATTCCTCCTCTAGCCGCATCTCCTCTGGGCTCTGACCAAGTCCTGTTTTTGTTCTACCCCAGGCAGCGACCATGC
GCAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACACTGGGGGACCTGATGTGGGGGGGTGTTGGGGGCAATA
GTGGACGCAGCTGTGCTATGGGGTTTCTTTGAATTGGATGTATTGAGCATGTGATGGGCTGTTTAAAGTGTCACCCCTCA
CTGTGACGGATATGAATTTGTTCATGAATATTTTATTTTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAG
ATTTGTTCACGCCTTCCCTTTGTGACTTCAAAAACCCTGACTCTCTTTCTGCAAAGGCACCTGAATGTGCCTGTGTTCCT
GTAGGCATAATATGAGGAGGTGGGGAGACCAACCCACCCCCATGTCCACCATGACCCTCTTCCCTCATGCTGACCTGTGT
TCCGTCTCCAATAATTAATCATTCCTGCTCCATAGAGGTGAGGCTGAGATGTCTCCATCTCTGTCTCAACTTTATGTGCA
CTGAGCTGTAACTTCTTACTTCCCTATTAAAA

IPD-IMGT/HLA

Sponsors