Allele Report for J*02:01

J*02:01 View HGVS Report
Pre-2010 Nomenclature: J*0201 Local Names: LCL721 / 59Kbd
IMGT/HLA Acc No: HLA02627 OMIM Entry: Not Listed
Assigned: 2006-08-23 Sequence Last Modified: 2006-10-06
Source Entries: M80470 , M96337  
Cells Sequence Derived From: LCL721  
Known Ethnic Origin Of Source: Unknown
Publications
Messer G et al. J Immunol 148:4043-53 1992. (View abstract)
Geraghty DE et al. J Immunol 149:1947-56 1992. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 1 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1094 bps)
ATGGGGTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCGGGACCCTGCCCTGGCCGAGACCTGGGCGGGCTCCCACTC
CATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGCCCAGCTTCATTGCCGTGGGCTACGTGGACGACA
CGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAGACGCGGGCGCGGTGGGTGGAGCAGGAGGGGCCG
GAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGACTGACCGAGTGAACCTGCGGACCCTGCTCCGCTA
CTACAACCAGAGCGAGGCGGGGTATCACATCCTCCAGGGAATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCTCC
GCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGAT
ACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCCAATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACCTG
CATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCCAAGACACACGTGACC
CACCCCCCTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGGCA
GCGGGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTGGG
CGGTTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCCTGCCCAAGCCCCTCAT
CCTGAGATGGGAGCCCTCTCCCCAGCCCACCATCCCCATTGTGGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGG
TCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCA
AGCAGCCAAAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3353 bps)
CAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGAGCCCCAGGCATGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGCATGG
GCTGGGGAGGTGCAGCATTGGGGATTCCCCATCTCCGCAGAGTTTCTCTTCTCCCTCTCCCAGCCTGCGACGGGTCCTTC
TTCCTGGACACTCACGACGCGGACCCAGTTCTCACTCCCACTGAGTGTCGGGTTTCTAGGGAAGCCAATCAGCGTCGCGC
GGCCCCGGTTCTAAAGTCCCCACGCACCACCGGGACTCGGAGTCTCCCCAGACGCCGACGATGGGGTCATGGCGCCCCGA
ACCCTCCTCCTGCTGCTCTCGGGACCCTGCCCTGGCCGAGACCTGGGCGGGTGAGTGCGGGGTCAGGAGGGAAACGGCCT
CTGCCGTGAGGAGCGAAAGGTCCACCTGGCTGGGGCGCAGGACCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCT
CAGCCCCTCCTCGCCCCCAGGCTCCCACTCCATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGCCCA
GCTTCATTGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAGACG
CGGGCGCGGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGACTGA
CCGAGTGAACCTGCGGACCCTGCTCCGCTACTACAACCAGAGCGAGGCGGGTGAGTGACCCCGGCCCGGGGCGCAGATCA
CTTACTCCCCGCTCCATGCCTCACGGACGGCCCTGGTCCCCTGAGTCTCCGGGTCCAAGATCGACCCCGAGGCTGCGGAC
CTGCAGAGATCCTCGACCCGGGAGAGCCCCAGGCGCCTTTACCTGGTTTCATCTTCAGTTGAGGCCAAAATCTCCGCAGG
TTGCTAGGGTCCGGGCCAGGGCTCGGTGGGCGGGGCTGACCGCGGGAACTGGGCCAGGGTATCACATCCTCCAGGGAATG
TTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCTCCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACATCGC
CCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCCAATG
TGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACCTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACG
CTGCAGCGCGCGGGGTACCAGGGGCCATGGGGAGCCTGCTCGATCTCCTGTAGATCTCCCGGGCTGGCCTCGCACAAGGA
GGGGAAGAAAATGGAAACACCACCAGAATATCGCCCTCCCTCCTGTCCTGACGGAGAGGAATCCTCCTGGGTTTCCAGAT
CCTGTATCAGAGATTGACTCTGAGGGCCCACCCTGCTCTTCCTGGGACAATTAAGGGATGAAGTCTCTGAGGGAGTGGAG
GGGAAGACAATCCCTGGAAGACTGATCCGCGGTCCCCTTTCACCCCACAGCAACCTTGGGCACCAGGACTTTTCCTCCCG
GGCCTTGTTCTCTGCCTCACACTCAATGTGTCGGAGTCTGACTCCAGCTCCTCTGAGTCCCTTGGCCTCCACTCAGATCA
GGACCAGAAGTCCCTGCTACCCTGCTCAGAGACTAGAACTTTCCAAGGAATAGGAGATTATCCCAGGCGCCTGTGTCCAG
GCTGGTGTCTGGGCTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTATTCATCAGGATGGTCACATGGGCGCTGCTGGGGT
GTCCCATGAGGAATGCAAAGTGCCTGAGTTTTCCGACTCTTCCTTTCAGACCCCCCCCAAGACACACGTGACCCACCCCC
CTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGGCAGCGGGAT
GGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTGGGCGGTTGT
GGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCCTGCCCAAGCCCCTCATCCTGAGA
TGGGGTAAGGAGAGAGATGGGGGCGGCCATGTCTCTTAGGGAAAGCAGGAGCCCCTCTGGAGACCTTTAGCAGGGTCGGG
GCTGGGTCCTGGAGGTCAGAACCCTCACATTCCCCTCCTTTCCCAGAGCCCTCTCCCCAGCCCACCATCCCCATTGTGGG
TATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGGTCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGAGCT
CAGGTGGGGAAGGGGTGAGGAGTCGGGTTTGAGTTTTCTTGTCCCACTGGGGGTTTCAAGCTCCAGGTAGAAATGTGTTC
TGCCTGGTTACCGGGAAGCACCATCCACATTCATGGGCCTACCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTGT
AAGCACCTGTGACAATGAAGGACAGATTTCTCACCTTGATGATTGTAGTGATGGGGATCTGACCCCAGTAATCACAGGTC
AGGGGAAGGTCCTGCTGAGGACAGACCTTAGGAGGGCAGTTGGTCAGGACCACATCTGCTTTCTTGTTTTCTGATCCTGC
CCTTGGTTTGCAGTCACACATTTCTGGAAACTTCTCGAGGTTCCAAGACTAGGAGGTTCCTCTAGGACCTCATGGCCCTG
CTACCTTCCTGGCCTCTCACAGGACGTTTTCTTCCCGCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTA
TGAAGGAGGCTGATCCCTGAGATCCTTGGGATATTGTGGTTGGGAGCCATGGGGGAGCTCACCCACCCCACAATTCCTCC
TCTAGCCACATCTCCTGTGGGATCTGACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGCCAAAGTGCCCAGGGCTCTGAT
GTGTCTCTCACGGCTTGTAAAGCTGAGACCCTGGGGAGGCTGATGTGTGTGGGTTGTTGGGGTAACAGTGGATATAGCTG
TGCTATGGGGTTTCTTTGACTTGGATGTATTCAGCACATGATGGGCTGTTGAAGGTGTGACCCCTCACTGTGAGTGATAT
GAATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTTGTTCATGCCT
TCCCTTTGTGACTTCAAGAACCCTGACTTCTCTTTCTGCAAAGGCATCTGAATGTGTCTGTGTCCCTATAGGC

IMGT/HLA

Sponsors

Animated Sponsors Logo