Allele Report for J*01:01:01:07

J*01:01:01:07 View HGVS Report
Pre-2010 Nomenclature: J*01010107 Local Names: Molt 4 / Molt4px
IMGT/HLA Acc No: HLA02628 OMIM Entry: Not Listed
Assigned: 2006-08-23 Sequence Last Modified: 2006-10-06
Source Entries: M80468  
Cells Sequence Derived From: MOLT-4  
Known Ethnic Origin Of Source: Unknown
Publications
Messer G et al. J Immunol 148:4043-53 1992. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1082 bps)
ATGGGGTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGCTCCCAC
TCCATGAGGTATTTCAGCACCGCGGTTTCCTGGCCGGGCCGCGGGGAGCCCAGCTTCATTGCCGTGGGCTACGTGGACGA
CACGCAGGTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAGACGCGGGCGCGGTGGGTGGAGCCAGGAGGGG
CCGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGACTGACCGAGTGAACCTGCGGACCCTGCTCCG
CTACTACAACCAGAGCGAGGCGGCGTATCACATCCTCCAGGGAATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCC
TCCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCG
GATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCCAATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCAC
CTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACACGTGA
CCCACCACCCTGTCTCTGAACATGAGGCATAACGAGGTGCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCT
GGCAGCGGGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAG
TGGGCGGTTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCT
CATCCTGAGATGGGAGCCCTCTCCCCAGCCCACCATCCCCATTGTGGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTG
TGGTCACTGCTGTGATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGCAGCCAAAGT
GCCCAGGGCTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3533 bps)
CAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGAGCCCCAGGCATGGCTCTCAGGGTCCCAGGCCCCGAAGGCGGTGCATGG
ACTGGGGAGGTGCAGCATTGGGGATTCCCCATCTCCGCAGAGTTTCTCTTCTCCCTCTCCCAGCCTGCGACGGGTCCTTC
TTCCTGGACACTCACGACGCGGACCCAGTTCTCACTCCCACTGAGTGTCGGGTTTCTAGGGAAGCCAATCAGCGTCGCGC
GGCCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCGGAGTCTCCCCAGACGCCGACGATGGGGTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGTGAGTGCGGGGTCAGGAGGGAAACGG
CCTCTGCCGTGAGGAGCGAAAGGTCCGCCTGGCTGGGGCGCAGGACCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGG
TCTCAGCCCCTCCTCGCCCCCAGGCTCCCACTCCATGAGGTATTTCAGCACCGCGGTTTCCTGGCCGGGCCGCGGGGAGC
CCAGCTTCATTGCCGTGGGCTACGTGGACGACACGCAGGTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAG
ACGCGGGCGCGGTGGGTGGAGCCAGGAGGGGCCGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGA
CTGACCGAGTGAACCTGCGGACCCTGCTCCGCTACTACAACCAGAGCGAGGCGGGTGAGTGACCCCGGCCCGGGGCGCAG
ATCACTTACTCCCCGCTCCATGCCTCACGGACGGCCCTGGTCCCCTGAGTCTCCGGGTCCAAGATCGACCCCGAGGCTGC
GGGACCTGCAGAGATCCTCGACCCGGGAGAGCCCCAGGCGCCTTTACCTGGTTTCATCTTCAGTTGAGGCCAAAATCTCC
GCAGGTTGCTAGGGGCGGGGCCGGGGCTCGGTGGGCGGGGCTGACCGCGGGAACTGGGCCTGCGTATCACATCCTCCAGG
GAATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCTCCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTAC
ATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGC
CAATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACCTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGG
AGACGCTGCAGCGCGCGGGGTACCAGGGGCCATGGGGAGCCTGCTCGATCTCCTGTAGATCTCCCGGGCTGGCCTCGCAC
AAGGAGGGGAAGAAAATGGAAACACCACCAGAATATCGCCCTCCCTCCTGTCCTGACGGAGAGGAATCCTCCTGGGTTTC
CAGATCCTGTATCAGAGATTGACTCTGAGGGCCCACCCTGCTCTTCCTGGGACAATTAAGGGATGAAGTCTCTGAAGGAG
TGGAGGGGAAGACAATCCCTGGAAGACTGATCCGCGGTCCCCTTTCACCCCACAGCAACCTTGGGCACCAGGACTTTTCC
TCCCGGGCCTTGTTCTCTGCCTCACACTCAATGTGTCGGAGTCTGACTCCAGCTCCTCTGAGTCCCTTGGCCTCCACTCA
GATCAGGACCAGAAGTCCCTGCTACCCTGCTCAGAGACTAGAACTTTCCAAGGAATAGGAGATTATCCCAGGCGCCTGTG
TCGAGGCTGGTGTCTGGGCTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTATTCATCAGGATGGTCACATGGGCGCTGCT
GGGGTGTCCCATGAGGAATGCAAAGTGCCTGAGTTTTCTGACTCTTCCTTTCAGACCCCCCCAAGACACACGTGACCCAC
CACCCTGTCTCTGAACATGAGGCATAACGAGGTGCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGGCAG
CGGGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTGGGC
GGTTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCTCATCC
TGAGATGGGGTAAGGAGAGAGATGGGGGCGGTCATGTCTCTTAGGGAAAGCAGGAGCCCCTCTGGAGACCTTTAGCAGGG
TCGGGGCTGGGTCCTGGAGGTCAGAACCCTCACATTCCCCTCCTTTCCCAGAGCCCTCTCCCCAGCCCACCATCCCCATT
GTGGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGAGCTCAGGTGGGGA
AGGGGTGAGGAGTGGGGTTTGAGTTTTCTTGTCCCACTGGGGGTTTCAAGCTCCAGGTAGAAATGTGTTCTGCCTGGTTA
CCGGGAAGCACCATCCACATTCATGGGCCTACCCAGCCTGGACCCTGTGTGCCAGCACTTACTCTTTTGTAAGCACCTGT
GACAATGAAGGACAGATTTCTCACCTTGATGATTGTAGTGATGGGGATCTGACCCCAGTAATCACAGGTCAGGGGAAGGT
CCCTGCTGAGGACAGACCTTAGGAGGGCAGTTGGTCCAGGACCCACATCTGCTTTCCTTGTTTTTCCTGATCCTGCCCTT
GGTTTGCAGTCACACATTTCTGGAAACTTCTCGAGGGTCCAAGACTAGGAGCTTCCTCTAGGACCTCATGGCCCTGCTAC
CTTCCTGGCCTCTCACAGGACGTTTTCTTCCCGCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAA
GGAGGCTGGATCCCTGAGATCCTTGGGATATTGTGGTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCCTCCTC
TAGCCACATCTCCTGTGGGATCTCACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGCCAAAGTGCCCAGGGCTCTGATGT
GTCTCTCACGGCTTGTAAAGGTGAGACCCTGGGGAGGCTGATGTGTGTGGGTTGTTGGGGTAACAGTGGATATAGCTGTG
CTATGGGGTTTCTTTGACTTGGATGTATTCAGCACATGATGGGCTGTTGAAGGTGTGACCCCTCACTGTGAGTGATATGA
ATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTTGTTCATGCCTTC
CCTTTGTGACTTCAAGAACCCTGACTTCTCTTTCTGCAAAGGCATCTGAATGTGTCTGTGTCCCTATAGGCATAATGTGA
GGTGGTGGGGAGACCAGCCCACACCCGTGTCCACCATGACCCTGTTCCCCACACTGACCTACATTCCTTCCCCGATCACC
TTTCCTGTTCCAGAGAAGTGGTGCTGGGATGTCTCCATCTCTGTCTCAACTTCATGGTGCACTGAGCTGTAACTTCTTAC
TTCCCTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo