Allele Report for J*01:01:01:04

J*01:01:01:04 View HGVS Report
Pre-2010 Nomenclature: J*01010104 Local Names: HLA-J,PGF
IMGT/HLA Acc No: HLA02630 OMIM Entry: Not Listed
Assigned: 2006-08-23 Sequence Last Modified: 2006-10-06
Source Entries: AL669914 , AL671277  
Cells Sequence Derived From: PGF  
Known Ethnic Origin Of Source: Caucasoid
Publications
Stewart CA et al. Genome Res 14:1176-87 2004. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1095 bps)
ATGGGGTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGCTCCCAC
TCCATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGCCCAGCTTCATTGCCGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAGACGCGGGCGCGGTGGGTGGAGCAGGAGGGGC
CGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGACTGACCGAGTGAACCTGCGGACCCTGCTCCGC
TACTACAACCAGAGCGAGGCGGGGTATCACATCCTCCAGGGAATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCT
CCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGG
ATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCCAATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACC
TGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCCAAGACACACGTGA
CCCACCCCCCTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGG
CAGCGGGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTG
GGCGGTTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCTCA
TCCTGAGATGGGAGCCCTCTCCCCAGCCCACCATCCCCATTGTGGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTG
GTCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGC
AAGCAGCCAAAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3545 bps)
CAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGAGCCCCAGGCATGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGCATGG
GCTGGGGAGGTGCAGCATTGGGGATTCCCCATCTCCGCAGAGTTTCTCTTCTCCCTCTCCCAGCCTGCGACGGGTCCTTC
TTCCTGGACACTCACGACGCGGACCCAGTTCTCACTCCCACTGAGTGTCGGGTTTCTAGGGAAGCCAATCAGCGTCGCGC
GGCCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCGGAGTCTCCCCAGACGCCGACGATGGGGTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGTGAGTGCGGGGTCAGGAGGGAAACGG
CCTCTGCCGTGAGGAGCGAAAGGTCCACCTGGCTGGGGCGCAGGACCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGG
TCTCAGCCCCTCCTCGCCCCCAGGCTCCCACTCCATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGC
CCAGCTTCATTGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAG
ACGCGGGCGCGGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGAC
TGACCGAGTGAACCTGCGGACCCTGCTCCGCTACTACAACCAGAGCGAGGCGGGTGAGTGACCCCGGCCCGGGGCGCAGA
TCACTTACTCCCCGCTCCATGCCTCACGGACGGCCCTGGTCCCCTGAGTCTCCGGGTCCAAGATCGACCCCGAGGCTGCG
GGACCTGCAGAGATCCTCGACCCGGGAGAGCCCCAGGCGCCTTTACCTGGTTTCATCTTCAGTTGAGGCCAAAATCTCCG
CAGGTTGCTAGGGGCCGGGCCAGGGCTCGGTGGGCGGGGCTGACCGCGGGAACTGGGCCAGGGTATCACATCCTCCAGGG
AATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCTCCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACA
TCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCC
AATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACCTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGA
GACGCTGCAGCGCGCGGGGTACCAGGGGCCATGGGGAGCCTGCTCGATCTCCTGTAGATCTCCCGGGCTGGCCTCGCACA
AGGAGGGGAAGAAAATGGAACCACCACCAGAATATCGCCCTCCCTCCTGTCCTGACGGAGAGGAATCCTCCTGGGTTTCC
AGATCCTGTATCAGAGATTGACTCTGAGGGCCCACCCTGCTCTTCCTGGGACAATTAAGGGATGAAGTCTCTGAGGGAGT
GGAGGGGAAGACAATCCCTGGAAGACTGATCCGCGGTCCCCTTTCACCCCACAGCAACCTTGGGCACCAGGACTTTTCCT
CCCGGGCCTTGTTCTCTGCCTCACACTCAATGTGTCGGAGTCTGACTCCAGCTCCTCTGAGTCCCTTGGCCTCCACTCAG
ATCAGGACCAGAAGTCCCTGCTACCCTGCTCAGAGACTAGAACTTTCCAAGGAATAGGAGATTATCCCAGGCGCCTGTGT
CCAGGCTGGTGTCTGGGCTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTATTCATCAGGATGGTCACATGGGCGCTGCTG
GGGTGTCCCATGAGGAATGCAAAGTGCCTGAGTTTTCCGACTCTTCCTTTCAGACCCCCCCCAAGACACACGTGACCCAC
CCCCCTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGGCAGCG
GGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTGGGCGG
TTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCTCATCCTG
AGATGGGGTAAGGAGAGAGATGGGGGCGGCCATGTCTCTTAGGGAAAGCAGGAGCCCCTCTGGAGACCTTTAGCAGGGTC
GGGGCTGGGTCCTGGAGGTCAGAACCCTCACATTCCCCTCCTTTCCCAGAGCCCTCTCCCCAGCCCACCATCCCCATTGT
GGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGGTCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGA
GCTCAGGTGGGGAAGGGGTGAGGAGTCGGGTTTGAGTTTTCTTGTCCCACTGGGGGTTTCAAGCTCCAGGTAGAAATGTG
TTCTGCCTGGTTACCGGGAAGCACCATCCACATTCATGGGCCTACCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTT
TGTAAGCACCTGTGACAATGAAGGACAGATTTCTCACCTTGATGATTGTAGTGATGGGGATCTGACCCCAGTAATCACAG
GTCAGGGGAAGGTCCCTGCTGAGGACAGACCTTAGGAGGGCAGTTGGTCCAGGACCCACATCTGCTTTCCTTGTTTTTCC
TGATCCTGCCCTTGGTTTGCAGTCACACATTTCTGGAAACTTCTCAAGGTTCCAAGACTAGGAGGTTCCTCTAGGACCTC
ATGGCCCTGCTACCTTCCTGGCCTCTCACAGGACGTTTTCTTCCCGCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGC
AAGTAAGTATGAAGGAGGCTGATCCCTGAGATCCTTGGGATATTGTGGTTGGGAGCCCATGGGGGAGCTCACCCACCCCA
CAATTCCTCCTCTAGCCACATCTCCTGTGGGATCTGACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGCCAAAGTGCCCA
GGGCTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACCCTGGGGAGGCTGATGTGTGTGGGTTGTTGGGGTAACAGTG
GATATAGCTGTGCTATGGGGTTTCTTTGACTTGGATGTATTCAGCACATGATGGGCTGTTGAAGGTGTGACCCCTCACTG
TGAGTGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTT
GTTCATGCCTTCCCTTTGTGACTTCAAGAACCCTGACTTCTCTTTCTGCAAAGGCATCTGAATGTGTCTGTGTCCCTATA
GGCATAATGTGAGGTGGTGGGGAGACCAGCCCACACCCGTGTCCACCATGACCCTGTTCCCCACACTGACCTACATTCCT
TCCCCGATCACCTTTCCTGTTCCAGAGAAGTGGTGCTGGGATGTCTCCATCTCTGTCTCAACTTCATGGTGCACTGAGCT
GTAACTTCTTACTTCCCTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo