Allele Report for J*01:01:01:01

J*01:01:01:01 View HGVS Report
Pre-2010 Nomenclature: J*01010101 Local Names: HLA-J, B30H3, MANN, CGM1
IMGT/HLA Acc No: HLA02626 OMIM Entry: Not Listed
Assigned: 2006-08-23 Sequence Last Modified: 2006-10-06
Source Entries: AC005404 , AF055066 , BX927229  
Cells Sequence Derived From: CGM1 , MOU  
Known Ethnic Origin Of Source: Caucasoid
Publications
Hampe A et al. DNA Seq 10:263-99 1999. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 3
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1095 bps)
ATGGGGTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGCTCCCAC
TCCATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGCCCAGCTTCATTGCCGTGGGCTACGTGGACGA
CACGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAGACGCGGGCGCGGTGGGTGGAGCAGGAGGGGC
CGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGACTGACCGAGTGAACCTGCGGACCCTGCTCCGC
TACTACAACCAGAGCGAGGCGGGGTATCACATCCTCCAGGGAATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCT
CCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGG
ATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCCAATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACC
TGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCCAAGACACACGTGA
CCCACCCCCCTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGG
CAGCGGGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTG
GGCGGTTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCTCA
TCCTGAGATGGGAGCCCTCTCCCCAGCCCACCATCCCCATTGTGGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTG
GTCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGC
AAGCAGCCAAAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA
Genomic Sequence Data (3545 bps)
CAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGAGCCCCAGGCATGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGCATGG
GCTGGGGAGGTGCAGCATTGGGGATTCCCCATCTCCGCAGAGTTTCTCTTCTCCCTCTCCCAGCCTGCGACGGGTCCTTC
TTCCTGGACACTCACGACGCGGACCCAGTTCTCACTCCCACTGAGTGTCGGGTTTCTAGGGAAGCCAATCAGCGTCGCGC
GGCCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCGGAGTCTCCCCAGACGCCGACGATGGGGTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCGGGGACCCTGGCCCTGGCCGAGACCTGGGCGGGTGAGTGCGGGGTCAGGAGGGAAACGG
CCTCTGCCGTGAGGAGCGAAAGGTCCACCTGGCTGGGGCGCAGGACCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGG
TCTCAGCCCCTCCTCGCCCCCAGGCTCCCACTCCATGAGGTATTTCAGCACCGCCGTTTCCTGGCCGGGCCGCGGGGAGC
CCAGCTTCATTGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGGTCGACAGTGACGCCGTGAGTCTGAGGATGAAG
ACGCGGGCGCGGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCTACAGACACTGGGCGCCAAGGCCCAGGCACAGAC
TGACCGAGTGAACCTGCGGACCCTGCTCCGCTACTACAACCAGAGCGAGGCGGGTGAGTGACCCCGGCCCGGGGCGCAGA
TCACTTACTCCCCGCTCCATGCCTCACGGACGGCCCTGGTCCCCTGAGTCTCCGGGTCCAAGATCGACCCCGAGGCTGCG
GGACCTGCAGAGATCCTCGACCCGGGAGAGCCCCAGGCGCCTTTACCTGGTTTCATCTTCAGTTGAGGCCAAAATCTCCG
CAGGTTGCTAGGGGCCGGGCCAGGGCTCGGTGGGCGGGGCTGACCGCGGGAACTGGGCCAGGGTATCACATCCTCCAGGG
AATGTTTGGCTGCGACCTGGGGCCCGACGGGCGTCTCCTCCGCGGGTATGAGCAGTATGCCTACGACGGCAAGGATTACA
TCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGATACCGCGGCTCAGATTACCCAGCGCAAGTATGAGGCGGCC
AATGTGGCTGAGCAAAGGAGAGCCTACCTGGAGGGCACCTGCATGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGA
GACGCTGCAGCGCGCGGGGTACCAGGGGCCATGGGGAGCCTGCTCGATCTCCTGTAGATCTCCCGGGCTGGCCTCGCACA
AGGAGGGGAAGAAAATGGAAACACCACCAGAATATCGCCCTCCCTCCTGTCCTGACGGAGAGGAATCCTCCTGGGTTTCC
AGATCCTGTATCAGAGATTGACTCTGAGGGCCCACCCTGCTCTTCCTGGGACAATTAAGGGATGAAGTCTCTGAGGGAGT
GGAGGGGAAGACAATCCCTGGAAGACTGATCCGCGGTCCCCTTTCACCCCACAGCAACCTTGGGCACCAGGACTTTTCCT
CCCGGGCCTTGTTCTCTGCCTCACACTCAATGTGTCGGAGTCTGACTCCAGCTCCTCTGAGTCCCTTGGCCTCCACTCAG
ATCAGGACCAGAAGTCCCTGCTACCCTGCTCAGAGACTAGAACTTTCCAAGGAATAGGAGATTATCCCAGGCGCCTGTGT
CCAGGCTGGTGTCTGGGCTCTGTGCTCCCTTCCCCACCCCAGGTGTCCTATTCATCAGGATGGTCACATGGGCGCTGCTG
GGGTGTCCCATGAGGAATGCAAAGTGCCTGAGTTTTCCGACTCTTCCTTTCAGACCCCCCCCAAGACACACGTGACCCAC
CCCCCTCTCTGAACATGAGGCATAACGAGGTCCTGGGTTCTGGGCTTCTACCCTGCGGAGATCACATTGACCTGGCAGCG
GGATGGGGAGGACCAGACCCAGGACATGGAGCTCGTGGAGACCAGGCCCACAGGGGATGGAACCTTCCAGAAGTGGGCGG
TTGTGGTAGTGCCTTCTGGAGAGGAACAGAGATACACATGCCATGTGCAGCACAAGGGGCTGCCCAAGCCCCTCATCCTG
AGATGGGGTAAGGAGAGAGATGGGGGCGGCCATGTCTCTTAGGGAAAGCAGGAGCCCCTCTGGAGACCTTTAGCAGGGTC
GGGGCTGGGTCCTGGAGGTCAGAACCCTCACATTCCCCTCCTTTCCCAGAGCCCTCTCCCCAGCCCACCATCCCCATTGT
GGGTATCATTGCTGGCCTGGTTCTCCTTGGAGCTGTGGTCACTGGAGCTGTGGTCACTGCTGTGATGTGGAGGAAGAAGA
GCTCAGGTGGGGAAGGGGTGAGGAGTCGGGTTTGAGTTTTCTTGTCCCACTGGGGGTTTCAAGCTCCAGGTAGAAATGTG
TTCTGCCTGGTTACCGGGAAGCACCATCCACATTCATGGGCCTACCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTT
TGTAAGCACCTGTGACAATGAAGGACAGATTTCTCACCTTGATGATTGTAGTGATGGGGATCTGACCCCAGTAATCACAG
GTCAGGGGAAGGTCCCTGCTGAGGACAGACCTTAGGAGGGCAGTTGGTCCAGGACCCACATCTGCTTTCCTTGTTTTTCC
TGATCCTGCCCTTGGTTTGCAGTCACACATTTCTGGAAACTTCTCGAGGTTCCAAGACTAGGAGGTTCCTCTAGGACCTC
ATGGCCCTGCTACCTTCCTGGCCTCTCACAGGACGTTTTCTTCCCGCAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGC
AAGTAAGTATGAAGGAGGCTGATCCCTGAGATCCTTGGGATATTGTGGTTGGGAGCCCATGGGGGAGCTCACCCACCCCA
CAATTCCTCCTCTAGCCACATCTCCTGTGGGATCTGACCAGGTTCTGTTTTTGTTCTACCCCAGGCAGCCAAAGTGCCCA
GGGCTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAGACCCTGGGGAGGCTGATGTGTGTGGGTTGTTGGGGTAACAGTG
GATATAGCTGTGCTATGGGGTTTCTTTGACTTGGATGTATTCAGCACATGATGGGCTGTTGAAGGTGTGACCCCTCACTG
TGAGTGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTT
GTTCATGCCTTCCCTTTGTGACTTCAAGAACCCTGACTTCTCTTTCTGCAAAGGCATCTGAATGTGTCTGTGTCCCTATA
GGCATAATGTGAGGTGGTGGGGAGACCAGCCCACACCCGTGTCCACCATGACCCTGTTCCCCACACTGACCTACATTCCT
TCCCCGATCACCTTTCCTGTTCCAGAGAAGTGGTGCTGGGATGTCTCCATCTCTGTCTCAACTTCATGGTGCACTGAGCT
GTAACTTCTTACTTCCCTATTAAAA

IMGT/HLA

Sponsors

Animated Sponsors Logo