Allele Report for H*02:06

H*02:06 View HGVS Report
Pre-2010 Nomenclature: H*0206 Local Names: lambda HLA 12
IMGT/HLA Acc No: HLA02555 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: J00191  
Alignment of CDS Source Entries
H*01:01:01:01
H*02:06
Submission 1

Locus Reference
  Virtual entry for H*02:06 
  Individual submission(s) 
Cells Sequence Derived From: JG  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Not defined
ISO OID: 2.16.840.1.113883.13.252 (HL7 Registered Organisational OID)
2.16.840.1.113883.13.252.1.1.2555 (Allele OID)
Publications
Malissen M et al. Proc Natl Acad Sci U S A 79:893-7 1982. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1097 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGTTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCGCCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCAAAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGCGCTCCG
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCCTTTCC
TCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCGGAGAGTCTACTTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACTTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAA
GTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCGAGCCCC
TCACCCTGAGATGGGAGCCATCTTCCCAGCCCACCGTCCCCATCGTGGGCATCGTTGCTGGCTTGGTTCTACTTGTAGCT
GTGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGC
TGCAAGCAGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCTTGAAACTGTGA
Genomic Sequence Data (0 bps)
Not Currently Available

IPD-IMGT/HLA

Sponsors