Allele Report for H*02:05

H*02:05 View HGVS Report
Pre-2010 Nomenclature: H*0205 Local Names: 5.4-LBF
IMGT/HLA Acc No: HLA02554 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: M32105  
Cells Sequence Derived From: LBF  
Known Ethnic Origin Of Source: Caucasoid
Publications
Zemmour J et al. J Immunol 144:3619-29 1990. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGCTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAAGCACGGACTGAACGAGAGAACCTGCGGATCGCGCTCCG
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACTTGGGGCCCGACGGGCGCTTCC
TCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCACACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAG
TGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTG
TGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCT
GCAAGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGTGTGA
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo