Allele Report for H*02:04

H*02:04 View HGVS Report
Pre-2010 Nomenclature: H*0204 Local Names: HLA-H,PGF
IMGT/HLA Acc No: HLA02552 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: AL645929  
Alignment of CDS Source Entries
H*01:01:01:01
H*02:04
Submission 1

Locus Reference
  Virtual entry for H*02:04 
  Individual submission(s) 
Cells Sequence Derived From: PGF  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Not defined
ISO OID: 2.16.840.1.113883.13.252 (HL7 Registered Organisational OID)
2.16.840.1.113883.13.252.1.1.2552 (Allele OID)
Publications
Stewart CA et al. Genome Res 14:1176-87 2004. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1104 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCTGACCCAGACCTGGGCGCG
CTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACG
TGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGG
GAGGGGCCAGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGC
GCTCCGCTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGC
GCTTCCTCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACC
GCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCTGAGAGCCTACCTGGA
GGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCCAAGACA
CATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCAC
ACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCT
TCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCC
GAGCCCCTCACCCTGAGATGGGAGCCATCTTCCCAGCCCAACGTCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACT
TGTAGCTGTGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACT
CTCAGGCTGCAAGCAGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCTTGAAAGTGTGA
Genomic Sequence Data (3533 bps)
lib/hgenomiclib:H_02:04GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCCCAGGCGTGGCTCTCAGGG
TCTCAGGCCCCGAAGGCGGTGTATGGATTGGGGATGCCCCGCCTTAGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTC
ACAACCTGCGACGGGTCCTTCTTCCTTGATACTCACGAAGCGGACACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAG
AGAAGCCAATCGGTGCCGCCGCGGTCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCG
AGGATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCTGACCCAGACCTGGGC
GCGTGAGTGCAGGGTCTGCAGGGAAATGGTCGGGAGGAGCGAGGGGCCCGCCCGGCGGGGGCGCAGGACCCGGGGATCCG
CGCAGGGAGGAGGGTCGGGCCGGTCTCAGCTCCTCCTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCAT
GTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCG
ACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGGCCAGAGTATTGGGACCGGAACACACAG
ATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGGCGGTGA
GTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCCCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCG
AGATCCACCCCGAAACCGCGGGACCCCGAGACCCTTGACCTGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAG
TTTAGGCCAAAACCCCCGCGGGTTGGTCGGGGCAGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGGCCAGGT
TCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAGCACGCCTA
CGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGC
GCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATAC
CTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGGTACCAGGGGCCACAGGGCGCCTCCCGGATCGCCTGTAGATCTCCG
GGGCTGGCCTCCCACAAGAAAGGGAGACAAATGGGACCAACACTATAATATCGCCCTCCCTCTGGTCTTGAGGGAGAAGA
ATCCTCCTGGGTTTCCAGAGAGTGACTCTGAGGGTCCGCCCTGCTCTCTGACACAATTAAGGGATGAAATCTGTGAGGAA
ATGAAGGGAAGACAATCCCTGGAATACTGATGAGTGGTTCCCTTTGACACTGGCAGCAGCCTTGGGCCCCGTGACTTTTC
CTCTCAGGCCTTGTTCTCTGCTTCACACTCAATGTGCGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCAC
TCAGGTCAGGACCAGAAGTCGCTGTTCCCTCTTCAGGGACTAGAATTTTCCACGGAATAGGAGATTATCCCAGGTGCCTG
TGTCCAGGCTGTTGTCTGGGTTCTGTGCTCCCTTCCCCACCCCAGGCATCCTGTCCATTCTCAAGATGGCCACATGCGTG
CTGGAGGAGTGTCCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCCAAGACACATATG
ACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGAC
CTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGA
AGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCGAGCCC
CTCACCCTGAGATGGGGTAAGGAGGGAGATGGGGGTGTCATGTCTCTTAGGGAAAGCCGGAGCCTCTCTGGAGAGCTTTA
GCAGGGTCAGGGTCCCTCACCTTCCCCCCTTTTCCCAGAGCCATCTTCCCAGCCCAACGTCCCCATCGTGGGCATCGTTG
CTGGCCTGGTTCTACTTGTAGCTGTGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAG
GAAGGGGTGAGGAGTGTGGTCTGAGATTTCTTGTCTCACTGAGAGTTCCAAGCCCCAGGTAGAAGTGCCCTGCCTGGTTA
CTGGGAAGCACCATCCACACTCATGGGCCTACCCAGCCTGGGCCGTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTG
TTACAATGAGGGACAGATTTATCACCTTGATGACTGTGGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAG
GTCCCCAAGGACAGACCTCAGAAGGGCGGTTGGTCCAGGACCCATATCTGCTTTCTTCATGTTTCCTGATCCCACCCTGG
GTCTGCAGTTGCACATTTCTGGAAACTTCTCTGGGGTCCGAGACTTGGAGGTTCCTCTAGGACCTTATGGCCCTGGCTTC
TTTCTGGCATCTCACAGGACATTTTCTTCCCACAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAG
GAGGCTGATCCCTGAAATCCTTTGGATATTGTGTTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTA
GCCACATCTACTGTGGGATCTGACCAGGTCCTGTTTTTATTCTACTCGAGGCAGCAACAGTGCCCAGGGCTCTGATGTGT
CTCTCACGGCTTGAAAGGTGAGACCTTGGGGGGCCTGATGTGTGGGGGATGTTGGGGGGGAACAGTGGACACAGCTGTGC
TATGGGGTTCTTTGAATTTGATGTTTTGAGCATGCGATGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATT
TGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGAGTTGTTCCTGCCTTCCCT
TTGTGACTTGAAGAACCCTGACTTTCTTTCTACAAAGGCACCTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAG
GAGGGGAGACCAACCCACCCTCATGTCCACCATGACCCTCTTCCCCACGCTGATCTGTGTTCCCTCCCCAATCATCTTTC
CTGTTCCAGAGAGGAGGGGCTGAGATGTCTCCATCTTTTTCTCAACTTTATGTGCACTGAGCTGTAACTTCTTACTTCCC
TCTTAAAATTAGA

IPD-IMGT/HLA

Sponsors