Allele Report for H*02:03

H*02:03 View HGVS Report
Pre-2010 Nomenclature: H*0203 Local Names: HLA-H,SSTO
IMGT/HLA Acc No: HLA02550 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: BX284699  
Cells Sequence Derived From: SSTO  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1090 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGACCCAGACCTGGGCGCGCTCCCACTCCAT
GAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACGATACGC
AGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGGCCGGAG
TATTGGGACCGGAACACACAGATCTGCAAGGCCCAAGCACGGACTGAACGAGAGAACCTGCGGATCGCGCTCCGCTACTA
CAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCCTCCGCG
GGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCGGACATG
GCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCGAGTTCGT
GGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGACCCACT
ACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAG
CGGGATGGGGAGGACCAGACCCACACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCG
GCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCGAGCCCCTCACCCT
GAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTACTTGTAGCTGTGGTCA
CTGGAGCTGTGGTCACTGCTGTAATGTGGAGGAAGAAGAGCTCAGATTGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGC
GGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGTGTGA
Genomic Sequence Data (3363 bps)
GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCCCAGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGTA
TGGATTGGGGAGGCCCCGCCTTGGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTCACAACCTGCGACGGGTCCTTTTT
CCTGGATACTCACGAAGCGGGCACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAGAGAAGCCAATCGGTGCCGCCGCG
GTCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGTGCTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCAGGGGCCCTGACCCAGACCTGGGCGCGTGAGTGCAGGGTCTGCAGGGAAATGGTCGGGA
GGAGCGAGGGGCCCGCCCGGCGGGGGCGCAGGACCCAGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAGCTCCTC
CTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCT
CCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCG
TGGATGGAGCGGGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAAGCACGGACTGAACGAGAGAA
CCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGGCGGTGAGTGACCCCGGCCCGGGACGCAGGTCACGACCCCTC
CCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCGAGATCCTCCCCGAAACCGCGGGACCCCGAGACCCT
TGACCTGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGGGGCAG
GGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGGCCAGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGT
GGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACC
TGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCTG
AGAGCCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGG
TACCAGGGGCCACAGGGCGCCTCCCGGATCGCCTGTAGATCTCCGGGGCTGGCCTCCCACAAGAAAGGGAGACAAATGGG
ACCAACACTATAATATCGCCCTCCCTCTGGTCCTGAGGGAGAAGAATCCTCCTGGGTTTCCAGAGAGTGACTCTGAGGGT
CCGCCGTGCTCTCTGACACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGGAAGACAATCCCTGGAATACTGATGAGT
GGTTCTCTTTGACACTGGCAGCAGCCTTGGGCCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACTCAATGT
GTGTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCCTCCTCA
GGGACTAGAGTTTTCCACGGAATAGGAGATTATCCCAGGTGCCTGTGTCCAGGCTGTTGTCTGGGTTCTGTGCTCCCTTC
CCCACCCCAGGCGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAAATGCCT
GAATTTTCTGACTCTTCCCGTCAGACCCCCCCAAGACACATATGACCCACTACCCCATCTCTGACCATGAGGCCACCCTG
AGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCACACACG
GAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCA
GAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCCGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATGGGGGTG
TCATGTCCCTTAGGGAAAGCCGGAGCCTCTCTGGAGAGCTTTAGCAGGGTCAGGGTCCCTCACCTTCCCCCCTTTTCCCA
GAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTACTTGTAGCTGTGGTCACTGGAGC
TGTGGTCACTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAGGAAGGGGTGAGGAGTGTGGTCTGAGATTTCTTGTCTC
ACTGAGAGTTCCAAGCCCCAGGTAGAAGGGCCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGC
CTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTACAACGAGGGACAGATTTATCACCTTGATGACTGT
GGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCCGAGGACAGACCTCAGAAGGGCGGTTGGTCCA
GGACCCACATCTGCTTTCCTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTTGCACATTTCTGGAAACTTCTCTGGGGT
CCAAGACTTGGAGGTTCCTCTAGGACCTTATGGCCCTGGCTTCTTTCTGGCATCTCACAGGACATTTTCTTCCCACAGAT
TGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATCCCTGAAATCCTTTGGATATTGTGTTTG
GGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTAGCCACATCTACTGTGGGATCTGACCAGGTCCTGTTTT
TATTCTACTCCAGGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGGTGAGACCTTGGGGGGCCTG
ATGTGTGGGGGGTGTTGGGGGGGAACAGTGGACACAGCTGTGCTATGGGGTTCTTTGAATTTGATGTTTTGAGCATGCGA
TGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTG
CCTTGTGTGGGACTGAGAGGCAAGATTTGTTCACACCTTCCCTTTGTGACTTGAAGAACCCTGACTTTCTGCAAAGGCAC
CTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAGGAGGGGAGACCAACCCACCCTCATGTCCACCATGACCCTCT
TCC

IMGT/HLA

Sponsors

Animated Sponsors Logo