Allele Report for H*02:01:01:02

H*02:01:01:02 View HGVS Report
Pre-2010 Nomenclature: H*02010102 Local Names: HLA-H,LCL727,Allele 2
IMGT/HLA Acc No: HLA02549 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: M96336  
Cells Sequence Derived From: LCL721  
Known Ethnic Origin Of Source: Unknown
CWD v2.0 Status: Not defined
Publications
Geraghty DE et al. J Immunol 149:1947-56 1992. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGCTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAAGCACGGACTGAACGAGAGAACCTGCGGATCGCGCTCCG
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCC
TCTGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCGGAGAGTCTACCTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCACACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAG
TGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTG
TGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCT
GCAAGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCGTGAAAGTGTGA
Genomic Sequence Data (3489 bps)
GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCAGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGTATG
GATTGGGGAGGCCCCGCCTTGGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTCACAACCTGCGACGGGTCCTTTTTCC
TGGATACTCACGAAGCGGGCACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAGAGAAGCCAATCGGTGCCGCCGCGGT
CCCGGTTCTAAAGTCCCCACGCACCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGTGCTCATGGCGCCCCGAAC
CCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGTGAGTGCAGGGTCTGCAGGGAAATGGTCG
GGAGGAGCGAGGGGCCCGCCCGGCGGGGGCGCAGGACCCAGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAGCTC
CTCCTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCA
TCTCCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGACGCGAGTCCGAGAGAGGAGCCGCGGGCG
CCGTGGATGGAGCGGGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAAGCACGGACTGAACGAGA
GAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGGCGTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCC
TCCCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCGAGATCCTCCCCGAAACCGCGGGACCCCGAGACC
CTTGACCTGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGTTGGTCCGGGCA
GGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGCCAGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGT
GGGGCCCGACGGGCGCTTCCTCTGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACC
TGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCGG
AGAGTCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGG
TACCAGGGGCCACAGGGCGCCTCCCGGATGGCCTGTAGATCTCCGGGGCTGGCCTCCCACAAGAAAGGGAGACAAATGGG
ACCAACACTATAATATCGCCCTCCCTCTGGTCCTGAGGGAGAAGAATCCTCCTGGGTTTCCAGAGAGTGACTCTGAGGGT
CCGCCGTGCTCTCTGACACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGGAAGACAATCCCTGGAATACTGATGAGT
GGTTCCCTTTGACGCTGGCAGCAGCCTTGGGCCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACTCAATGT
GCCTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCCTCCTCA
GGGACTAGAATTTTCCACGGAATAGGAGATTATCCCAGGTGCCTGTGTCCAGGCTGTTGTCTGGGTTCTGTGCTCCCTTC
CCCACCCCAGGCGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAAATGCCT
GAATTTTCTGACTCTTCCCGTCAGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCACCCTG
AGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCACACACG
GAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCA
GAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATGGGGGTG
TCATGTCCCTTAGGGAAAGCCAGAGCCTCTCTGGAGAGCTTTAGCAGGGTCAGGGTCCCTCACCTTCCCCCCTTTTCCCA
GAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTGTGGTCACTGGAGC
TGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAGGAAGGGGTGAGGAGTGTGGTCTGAGATTTCTTGTCTC
ACTGAGAGTTCCAAGCCCCAGGTAGAAGTGCCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTACCCAGC
CTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTACAATGAGGGACAGATTTATCACCTTGATGACTGT
GGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCCGAGGACAGACCTCAGAAGGGCGGTTGGTCCA
GGACCCACATCTGCTTTCCTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTTGCACATTTCTGGAAACTTCTCTGGGGT
CCAAGACTTGGAGGTTCCTCTAGGACCTTATGGCCCTGGCTTCTTTCTGGCATCTCACAGGACATTTTCTTCCCACAGAT
AGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATCCCTGAAATCCTTTGGATATTGTGTTTG
GGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTAGCCACATCTACTGTGGGATCTGACCAGGTCCTGTTTT
TATTCTACTCCAGGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCGTGAAAGGTGAGACCTTGGGGGGCCTG
ATGTGTGGGGGGTGTTGGGGGGGAACAGTGGACACAGCTGTGCTATGGGGTTCTTTGAATTTGATGTTTTGAGCATGCGA
TGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGACAGCTG
CCTTGTGTGGGACTGAGAGGCAAGATTTGTTCACACCTTCCCTTTGTGACTTGAAGAACCCTGACTTTCTGCAAAGGCAC
CTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAGGAGGGGAGACCAACCCACCCTCATGTCCACCATGACCCTCT
TCCCCACGCTGATCTGTGTTCCCTCCCCAATCATCTTTCCTGTTCCAGAGAGGCGGGGCTGAGATGTCTCCATCTTTTTC
TCACTTTATGTGCACTGAGCTGTAACTCTTACTCCCTCTTAAAATTAGA

IMGT/HLA

Sponsors

Animated Sponsors Logo