Allele Report for H*01:02

H*01:02 View HGVS Report
Pre-2010 Nomenclature: H*0102 Local Names: HLA-H,QBL
IMGT/HLA Acc No: HLA02551 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: AL845454  
Cells Sequence Derived From: QBL  
Known Ethnic Origin Of Source: Caucasoid
Publications
Traherne JA et al. PLoS Genetics 2:81-92 2006. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGCTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGCGCTCCT
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCC
TCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCACACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAG
TGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTG
TGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCT
GCAAGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGTGTGA
Genomic Sequence Data (3375 bps)
GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCCCAGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGTA
TGGATTGGGGAGGCCCCGCCTTGGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTCACAACCTGCGACGGGTCCTTTTT
CCTGGATACTCAGGAAGCGGGCACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAGAGAAGCCAATCGGTGCCGCCGCG
GTCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGTGCTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGTGAGTGCAGGGTCTGCAGGGAAATGG
TCGGGAGGAGCGAGGGGCCCGCCCGGCGGGGGCGCAGGACCCAGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAG
CTCCTCCTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCT
TCATCTCCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGG
GCGCCGTGGATGGAGCGGGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACG
AGAGAACCTGCGGATCGCGCTCCTCTACTACAACCAGAGCGAGGGCGGTGAGTGACCCCGGCCCGGGACGCAGGTCACGA
CCCCTCCCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCGAGATCCTCCCCGAAACCGCGGGACCCCGA
GACCCTTGACCTGGGAGAGGCCCAGGCGCCTTTACCCGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGG
GGCAGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGGCCAGGTTCTCACACCATGCAGGTGATGTATGGCTGC
GACGTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAGCACGCCTACGACGGCAAGGATTACATCGCTCTGAACGA
GGACCTGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCGGGCGGAGC
AGCTGAGAGCCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGC
GCGGGTACCAGGGGCCACAGGGCGCCTCCCGGATCGCCTGTAGATCTCCGGGGCTGGCCTCCCACAAGAAAGGGAGACAA
ATGGGACCAACACTATAATATCGCCCTCCCTCTGGTCCTGAGGGAGAAGAATCCTCCTGGGTTTCCAGAGAGTGACTCTG
AGGGTCCGCCGTGCTCTTTGACACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGGAAGACAATCCCTGGAATACTGA
TGAGTGGTTCCCTTTGACACTGGCAGCAGCCTTGGGCCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACTC
AATGTGCCTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCCT
CCTCAGGGACTAGAATTTTCCACGGAATAGGAGATTATCCCAGGTGCCTGTGTCCAGGCTGTTGTCTGGGTTCTGTGCTC
CCTTCCCCACCCCAGGCGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAAA
TGCCTGAATTTTCTGACTCTTCCTGTCAGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCA
CCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAC
ACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAG
GAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATGG
GGGTGTCATGTCCCTTAGGGAAAGCCGGAGCCTCTCTGGAGAGCTTTAGCAGGGTCAGGGTCCCTCACCTTCCCCTCTTT
TCCCAGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTGTGGTCACT
GGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAGGAAGGGGTGAGGAGTGTGGTCTGAGATTTCTT
GTCTCACTGAGAGTTCCAAGCCCCAGGTAGAAGTGCCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTAC
CCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTACAATGAGGGACAGATTTATCACCTTGATG
ACTGTGGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCCGAGGACAGACCTCAGAAGGGCGGTTG
GTCCAGGACCCACATCTGCTTTCCTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTTGCACATTTCTGGAAACTTCTCT
GGGGTCCAAGACTTGGAGGTTCCTCTAGGACCTTATGGCCCTGGCTTCTTTCTGGCATCTCACAGGACATTTTCTTCCCA
CAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATCCCTGAAATCCTTTGGATATTGT
GTTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTAGCCACATCTACTGTGGGATCTGACCAGGTCCT
GTTTTTATTCTACTCCAGGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGGTGAGACCTTGGGGG
GCCTGATGTGTGGGGGGTGTTGGGGGGGAACAGTGGACACAGCTGTGCTATGGGGTTCTTTGAATTTGATGTTTTGAGCA
TGCGATGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGAC
AGCTGCCTTGTGTGGGACTGAGAGGCAAGATTTGTTCACACCTTCCCTTTGTGACTTGAAGAACCCTGACTTTCTGCAAA
GGCACCTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAGGAGGGGAGACCAACCCACCCTCATGTCCACCATGAC
CCTCTTCCCCACGCT

IMGT/HLA

Sponsors

Animated Sponsors Logo