Allele Report for H*01:01:01:02

H*01:01:01:02 View HGVS Report
Pre-2010 Nomenclature: H*01010102 Local Names: JY8
IMGT/HLA Acc No: HLA02557 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: X12432  
Cells Sequence Derived From: JY  
Known Ethnic Origin Of Source: Caucasoid
Publications
Duceman B et al. Nucleic Acids Res 16:10391-10391 1988. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGCTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGCGCTCCG
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCC
TCCGCGGGTATGAACAGCACGCCTACGACAGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCACACACGGAGCTCATGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAG
TGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTG
TGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCT
GCAAGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGTGTGA
Genomic Sequence Data (3503 bps)
GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCCCACGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGT
ATGGATTGGGGAGGCCCCGCCTTGGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTCACAACCTGCGACGGGTCCTTTT
TCCTGGATACTCAGGAAGCGGGCACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAGAGAAGCCAATCGGTGCCGCCGC
GGTCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGTGCTCATGGCGCCCC
GAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGTGAGTGCAGGGTCTGCAGGGAAATG
GTCGGGAGGAGCGAGGGGCCCGCCCGGCGGCGCGCAGGACCCAGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAG
CTCCTCCTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCT
TCATCTCCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGG
GCGCCGTGGATGGAGCGGGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACG
AGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGGCGGTGAGTGACCCCGGCCCGGACGCAGGTCACGAC
CCCTCCCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCGAGATCCTCCCCGAAACCGCGGGACCCCGAG
ACCCTTGACCTGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGG
GGCAGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGGCCAGGTTCTCACACCATGCAGGTGATGTATGGCTGC
GACGTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAGCACGCCTACGACAGCAAGGATTACATCGCTCTGAACGA
GGACCTGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCAGGCGGAGC
AGCTGAGAGCCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGC
GCGGGTACCAGGGGCCACAGGGCGCCTCCCGGATGGCCTGTAGATCTCCGGGGCTGGCCTCCCACAAGAAAGGGAGACAA
ATGGGACCAACACTATAATATCGCCCTCCCTCTGGTCCTGAGGGAGAAGAATCCTCCTGGGTTTCCAGAGAGTGACTCTG
AGGGTCCGCCGTGCTCTTTGACACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGGAAGACAATCCCTGGAATACTGA
TGAGTGGTTCCCTTTGACACTGGCAGCAGCCTTGGGCCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACTC
AATGTGCCTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCCT
CCTCAGGGACTAGAATTTTCCACGGAATAGGAGATTATCCCAGGTGCCTGTGTCCAGGCTGTTGTCTGGGTTCTGTGCTC
CCTTCCCCACCCCAGGCGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAAA
TGCCTGAATTTTCTGACTCTTCCTGTCAGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCCA
CCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAC
ACACGGAGCTCATGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAG
GAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATGG
GGGTGTCATGTCCCTTAGGGAAAGCTCGACCGGAGCCTCTCTGGAGAGCTTTAGCAGGGTCAGGGTCCCTCACCTTCCCC
CCTTTTCCCAGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTGTGG
TCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAGGAAGGGGTGAGGAGTGTGGTCTGAGAT
TTCTTGTCTCACTGAGAGTTCCAAGCCCCAGGTACAAGTGCCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGG
CCTACCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTACAATGAGGGACAGATTTATCACCT
TGATGACTGTGGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCCGAGGACAGACCTCAGAAGGGC
GGTTGGTCCAGGACCCACATCTGCTTTCCTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTTGCACATTTCTGGAAACT
TCTCTGGGGTCCAAGACTTGGAGGTTTCCTCTAGGACCTTATGGCCCTGGCTTCTTTCTGGCATCTCACAGGACATTTTC
TTCCCACAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATCCCTGAAATCCTTTGGA
TATTGTGTTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTAGCCACATCTACTGTGGGATCTGACCA
GGTCCTGTTTTTATTCTACTCCAGGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGGTGAGACCT
TGGGGGGCCTGATGTGTGGGGGGTGTTGGGGGGGAACAGTGGACACAGCTGTGCTATGGGGTTCTTTGAATTTGATGTTT
TGAGCATGCGATGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATTTGTTCATGAATATTTTTTCTATAGTG
TGAGACAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTTGTTCACACCTTCCCTTTGTGACTTGAAGAACCCTGACTTTC
TGCAAAGGCACCTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAGGAGGGGAGACCAACCCACCCTCATGTCCAC
CATGACCCTCTTCCCCTCGCTGATCTGTGTTCCCTCCCCAATCATCTTTCCTGTTCCAGAGAGGCGGGGCTGAGATGTCT
CCATCTTTTTCTCAACTTTATGTGCACTGAGCTGTAACTTCTTACTTCCCTCTTAAAATTAGA

IMGT/HLA

Sponsors

Animated Sponsors Logo